Incidental Mutation 'R4401:Rpf2'
ID326637
Institutional Source Beutler Lab
Gene Symbol Rpf2
Ensembl Gene ENSMUSG00000038510
Gene Nameribosome production factor 2 homolog
Synonyms2810470K21Rik, Bxdc1
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40223246-40247036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40236128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000138581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045114] [ENSMUST00000181995] [ENSMUST00000183052] [ENSMUST00000183114] [ENSMUST00000183309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045114
AA Change: V71A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035456
Gene: ENSMUSG00000038510
AA Change: V71A

DomainStartEndE-ValueType
Brix 1 195 3.25e-51 SMART
low complexity region 208 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181995
AA Change: V78A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138425
Gene: ENSMUSG00000038510
AA Change: V78A

DomainStartEndE-ValueType
Brix 34 202 8.11e-29 SMART
low complexity region 215 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183052
SMART Domains Protein: ENSMUSP00000138646
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 34 175 6.08e-10 SMART
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183114
SMART Domains Protein: ENSMUSP00000138750
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 3 149 1.26e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183309
AA Change: V104A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138581
Gene: ENSMUSG00000038510
AA Change: V104A

DomainStartEndE-ValueType
Brix 34 228 3.25e-51 SMART
low complexity region 241 252 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Rpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Rpf2 APN 10 40239759 nonsense probably null
R0190:Rpf2 UTSW 10 40227601 missense probably damaging 1.00
R1880:Rpf2 UTSW 10 40233158 missense possibly damaging 0.52
R1912:Rpf2 UTSW 10 40236201 missense probably benign 0.22
R2989:Rpf2 UTSW 10 40239753 missense probably benign 0.02
R4843:Rpf2 UTSW 10 40247002 unclassified probably benign
R5092:Rpf2 UTSW 10 40246975 start codon destroyed probably null 0.63
R5394:Rpf2 UTSW 10 40233185 missense possibly damaging 0.48
R5473:Rpf2 UTSW 10 40227631 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCCAATGGCTTGTAAGTTCTG -3'
(R):5'- CCATGAGCTTACAGGTAAGATGG -3'

Sequencing Primer
(F):5'- GCCAATGGCTTGTAAGTTCTGAAAAC -3'
(R):5'- GAGACAGTCTCTTGCTGTGTAGC -3'
Posted On2015-07-07