Mutagenetix > Incidental Mutations

Incidental Mutation 'R4401:Srgap1'

326639

Institutional Source

Beutler Lab

Gene Symbol

Srgap1

Ensembl Gene

ENSMUSG00000020121

Gene Name

SLIT-ROBO Rho GTPase activating protein 1

Synonyms

Arhgap13, 4930572H05Rik

MMRRC Submission

041132-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.262) question?

Stock #

R4401 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121780991-122047315 bp(-) (GRCm38)

Type of Mutation

unclassified (1719 bp from exon)

DNA Base Change (assembly)

T to C at 121804921 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688] [ENSMUST00000161156]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020322
AA Change: N657S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: N657S

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	494	668	1.27e-64	SMART
SH3	723	778	1.57e-14	SMART
low complexity region	826	840	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081688
AA Change: N680S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: N680S

Domain	Start	End	E-Value	Type
FCH	22	121	3.81e-16	SMART
low complexity region	173	193	N/A	INTRINSIC
coiled coil region	352	382	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
RhoGAP	517	691	1.27e-64	SMART
SH3	746	801	1.57e-14	SMART
low complexity region	849	863	N/A	INTRINSIC
low complexity region	1027	1037	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000161156

SMART Domains

Protein: ENSMUSP00000125109
Gene: ENSMUSG00000020121

Domain	Start	End	E-Value	Type
Pfam:RhoGAP	1	68	2.6e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161996

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	G	5: 8,702,390	I454V	possibly damaging	Het
Acvr2a	A	G	2: 48,899,702	T486A	probably benign	Het
Ap3b1	C	A	13: 94,418,099	L248I	probably damaging	Het
Atad2b	T	A	12: 4,940,145	C157S	probably damaging	Het
C530008M17Rik	G	A	5: 76,848,916	V74I	probably damaging	Het
Cage1	T	A	13: 38,023,102	I256F	probably damaging	Het
Cct2	A	G	10: 117,057,809	I287T	possibly damaging	Het
Cntn4	A	G	6: 106,489,664	T176A	possibly damaging	Het
Cyp2c54	T	C	19: 40,072,171	N122S	probably benign	Het
Cytip	T	C	2: 58,133,935	D291G	probably benign	Het
Eef1d	C	T	15: 75,902,920	V213I	probably benign	Het
Fnbp4	A	G	2: 90,746,758	T145A	possibly damaging	Het
Fras1	C	A	5: 96,642,620	T951K	probably damaging	Het
Gm11937	C	T	11: 99,610,075	V39M	probably damaging	Het
Gm6712	C	T	17: 17,318,104		noncoding transcript	Het
Hira	A	G	16: 18,925,720	I352V	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lpcat2	T	C	8: 92,873,055	V217A	possibly damaging	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Olfr1277	A	G	2: 111,269,833	F178S	probably damaging	Het
Olfr447	G	T	6: 42,912,326	E268*	probably null	Het
Olfr561	C	T	7: 102,774,799	R92*	probably null	Het
Pla2g1b	T	A	5: 115,470,888	Y47*	probably null	Het
Pqlc2	T	C	4: 139,306,543	I22V	probably benign	Het
Rfng	A	T	11: 120,782,480	V245E	possibly damaging	Het
Rpf2	A	G	10: 40,236,128	V104A	possibly damaging	Het
Rps6kc1	G	T	1: 190,799,958	H616N	probably benign	Het
Slc9b2	T	C	3: 135,336,544	V528A	probably benign	Het
Trrap	A	G	5: 144,843,318	T3240A	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Zfhx4	C	A	3: 5,403,345	Y2854*	probably null	Het
Zfp986	C	T	4: 145,898,943	R58C	probably benign	Het

Other mutations in Srgap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01964:Srgap1	APN	10	121804966	missense	possibly damaging	0.81
IGL02106:Srgap1	APN	10	121785693	missense	possibly damaging	0.95
IGL02927:Srgap1	APN	10	121855462	missense	probably damaging	0.99
IGL03088:Srgap1	APN	10	121825693	missense	possibly damaging	0.94
IGL03208:Srgap1	APN	10	121792266	missense	possibly damaging	0.89
IGL03251:Srgap1	APN	10	121804921	unclassified	probably null
PIT1430001:Srgap1	UTSW	10	121896753	splice site	probably benign
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0052:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R0356:Srgap1	UTSW	10	121855536	splice site	probably null
R0361:Srgap1	UTSW	10	122047192	start codon destroyed	probably null	0.89
R0365:Srgap1	UTSW	10	121785705	missense	possibly damaging	0.80
R0675:Srgap1	UTSW	10	121792235	missense	probably damaging	1.00
R0801:Srgap1	UTSW	10	121807875	missense	probably damaging	0.96
R0815:Srgap1	UTSW	10	121785474	missense	probably damaging	0.99
R1034:Srgap1	UTSW	10	121785445	missense	possibly damaging	0.69
R1160:Srgap1	UTSW	10	121855477	missense	probably benign	0.01
R1454:Srgap1	UTSW	10	121896738	missense	probably damaging	0.99
R1624:Srgap1	UTSW	10	121855373	missense	probably benign	0.03
R1628:Srgap1	UTSW	10	121870339	missense	probably benign	0.15
R1816:Srgap1	UTSW	10	121925971	nonsense	probably null
R1933:Srgap1	UTSW	10	121925903	missense	possibly damaging	0.89
R2034:Srgap1	UTSW	10	121792746	missense	probably damaging	0.98
R2211:Srgap1	UTSW	10	121853740	missense	possibly damaging	0.55
R2295:Srgap1	UTSW	10	121794760	missense	probably benign	0.03
R2368:Srgap1	UTSW	10	121829289	missense	probably benign	0.05
R3796:Srgap1	UTSW	10	122047132	missense	probably benign	0.06
R4083:Srgap1	UTSW	10	121785690	missense	probably damaging	1.00
R4172:Srgap1	UTSW	10	121855363	missense	probably benign	0.00
R4322:Srgap1	UTSW	10	121869806	missense	probably damaging	1.00
R4513:Srgap1	UTSW	10	121870326	critical splice donor site	probably null
R4698:Srgap1	UTSW	10	121792487	missense	probably benign	0.22
R4776:Srgap1	UTSW	10	121792351	missense	probably benign	0.03
R4951:Srgap1	UTSW	10	121785552	missense	probably benign	0.20
R5116:Srgap1	UTSW	10	121792379	missense	possibly damaging	0.77
R5232:Srgap1	UTSW	10	121840911	missense	probably benign	0.00
R5237:Srgap1	UTSW	10	121807883	missense	probably damaging	1.00
R5335:Srgap1	UTSW	10	121785377	utr 3 prime	probably benign
R5402:Srgap1	UTSW	10	121785760	missense	probably benign	0.06
R5432:Srgap1	UTSW	10	121869823	missense	probably damaging	1.00
R5456:Srgap1	UTSW	10	121869811	missense	probably benign	0.45
R5669:Srgap1	UTSW	10	121804850	missense	probably benign	0.00
R5682:Srgap1	UTSW	10	121805014	missense	probably damaging	1.00
R5687:Srgap1	UTSW	10	121825636	missense	probably damaging	1.00
R5773:Srgap1	UTSW	10	121896709	missense	probably benign	0.02
R5832:Srgap1	UTSW	10	121840914	missense	probably damaging	1.00
R6028:Srgap1	UTSW	10	121828730	missense	probably null
R6240:Srgap1	UTSW	10	122047156	missense	probably benign	0.06
R6336:Srgap1	UTSW	10	121925941	missense	probably benign	0.01
R6435:Srgap1	UTSW	10	121800827	missense	possibly damaging	0.94
R6597:Srgap1	UTSW	10	121792371	missense	probably benign	0.11
R6798:Srgap1	UTSW	10	121925904	missense	probably damaging	1.00
R6897:Srgap1	UTSW	10	121785618	missense	probably damaging	0.96
X0063:Srgap1	UTSW	10	121785412	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACTCTCATAGTTCATGGGCAG -3'
(R):5'- TTAAGTGCTTTGTTTTCCCAAACCG -3'

Sequencing Primer
(F):5'- AGTAAGCACTTTAGACTCCCTGG -3'
(R):5'- GTTTTCCCAAACCGTCTGTTAC -3'

Posted On

2015-07-07