Incidental Mutation 'R4401:Gm11937'
ID326640
Institutional Source Beutler Lab
Gene Symbol Gm11937
Ensembl Gene ENSMUSG00000058725
Gene Namepredicted gene 11937
Synonyms
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99609794-99610189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99610075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 39 (V39M)
Ref Sequence ENSEMBL: ENSMUSP00000075802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074926] [ENSMUST00000076478]
Predicted Effect probably benign
Transcript: ENSMUST00000074926
SMART Domains Protein: ENSMUSP00000074461
Gene: ENSMUSG00000060756

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 56 5.8e-4 PFAM
Pfam:Keratin_B2 1 72 2.6e-12 PFAM
Pfam:Keratin_B2_2 53 101 1.3e-5 PFAM
Pfam:Keratin_B2_2 92 131 6.1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076478
AA Change: V39M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075802
Gene: ENSMUSG00000058725
AA Change: V39M

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 56 5.8e-4 PFAM
Pfam:Keratin_B2 1 72 2.6e-12 PFAM
Pfam:Keratin_B2_2 53 101 1.3e-5 PFAM
Pfam:Keratin_B2_2 92 131 6.1e-4 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Gm11937
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03273:Gm11937 APN 11 99609801 unclassified probably benign
R1355:Gm11937 UTSW 11 99609907 missense possibly damaging 0.94
R6736:Gm11937 UTSW 11 99610074 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAATGTCAGTTGGCTCAGCAG -3'
(R):5'- GAGGAGACATCACACCTGAG -3'

Sequencing Primer
(F):5'- GCTCAGCAGCAGGTGTTG -3'
(R):5'- GAGGAGACATCACACCTGAGAACTC -3'
Posted On2015-07-07