Incidental Mutation 'R4401:Rfng'
ID326641
Institutional Source Beutler Lab
Gene Symbol Rfng
Ensembl Gene ENSMUSG00000025158
Gene NameRFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsradical fringe
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120780746-120784207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120782480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 245 (V245E)
Ref Sequence ENSEMBL: ENSMUSP00000026156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026156] [ENSMUST00000100134] [ENSMUST00000116305] [ENSMUST00000153678] [ENSMUST00000172809] [ENSMUST00000208737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026156
AA Change: V245E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026156
Gene: ENSMUSG00000025158
AA Change: V245E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 54 306 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100134
SMART Domains Protein: ENSMUSP00000097711
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 4.9e-78 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116305
SMART Domains Protein: ENSMUSP00000112007
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 1.3e-77 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144519
Predicted Effect probably benign
Transcript: ENSMUST00000153678
Predicted Effect probably benign
Transcript: ENSMUST00000172809
SMART Domains Protein: ENSMUSP00000133855
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:RPN7 162 344 8.8e-77 PFAM
PINT 395 478 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208737
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display a completely normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Rfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Rfng APN 11 120783952 missense probably damaging 0.99
IGL01073:Rfng APN 11 120783921 missense probably benign 0.01
IGL01748:Rfng APN 11 120783743 missense probably benign 0.00
R1533:Rfng UTSW 11 120781861 nonsense probably null
R2697:Rfng UTSW 11 120784039 unclassified probably benign
R4169:Rfng UTSW 11 120783946 missense probably benign 0.10
R4613:Rfng UTSW 11 120782650 missense probably damaging 1.00
R4738:Rfng UTSW 11 120783964 missense probably damaging 1.00
R5015:Rfng UTSW 11 120783050 missense probably damaging 0.98
R5703:Rfng UTSW 11 120782016 missense probably benign 0.40
R6191:Rfng UTSW 11 120782690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACAACTGGAGACCCCTTG -3'
(R):5'- CAGTGAAATTCTGGTTTGCTACTGG -3'

Sequencing Primer
(F):5'- CCTTGGGAGCTAGGCTGC -3'
(R):5'- CTGGGTTCTGCCTGAGC -3'
Posted On2015-07-07