Mutagenetix > Incidental Mutations

Incidental Mutation 'R4401:Atad2b'

326642

Institutional Source

Beutler Lab

Gene Symbol

Atad2b

Ensembl Gene

ENSMUSG00000052812

Gene Name

ATPase family, AAA domain containing 2B

Synonyms

D530031C13Rik, 1110014E10Rik

MMRRC Submission

041132-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4401 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4917353-5047394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4940145 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 157 (C157S)

Ref Sequence

ENSEMBL: ENSMUSP00000047445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045664
AA Change: C157S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: C157S

Domain	Start	End	E-Value	Type
low complexity region	13	54	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	252	278	N/A	INTRINSIC
AAA	432	573	4.56e-20	SMART
SCOP:d1e32a2	771	912	3e-4	SMART
BROMO	958	1070	4.24e-20	SMART
low complexity region	1135	1144	N/A	INTRINSIC
low complexity region	1230	1253	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219187

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	G	5: 8,702,390	I454V	possibly damaging	Het
Acvr2a	A	G	2: 48,899,702	T486A	probably benign	Het
Ap3b1	C	A	13: 94,418,099	L248I	probably damaging	Het
C530008M17Rik	G	A	5: 76,848,916	V74I	probably damaging	Het
Cage1	T	A	13: 38,023,102	I256F	probably damaging	Het
Cct2	A	G	10: 117,057,809	I287T	possibly damaging	Het
Cntn4	A	G	6: 106,489,664	T176A	possibly damaging	Het
Cyp2c54	T	C	19: 40,072,171	N122S	probably benign	Het
Cytip	T	C	2: 58,133,935	D291G	probably benign	Het
Eef1d	C	T	15: 75,902,920	V213I	probably benign	Het
Fnbp4	A	G	2: 90,746,758	T145A	possibly damaging	Het
Fras1	C	A	5: 96,642,620	T951K	probably damaging	Het
Gm11937	C	T	11: 99,610,075	V39M	probably damaging	Het
Gm6712	C	T	17: 17,318,104		noncoding transcript	Het
Hira	A	G	16: 18,925,720	I352V	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lpcat2	T	C	8: 92,873,055	V217A	possibly damaging	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Olfr1277	A	G	2: 111,269,833	F178S	probably damaging	Het
Olfr447	G	T	6: 42,912,326	E268*	probably null	Het
Olfr561	C	T	7: 102,774,799	R92*	probably null	Het
Pla2g1b	T	A	5: 115,470,888	Y47*	probably null	Het
Pqlc2	T	C	4: 139,306,543	I22V	probably benign	Het
Rfng	A	T	11: 120,782,480	V245E	possibly damaging	Het
Rpf2	A	G	10: 40,236,128	V104A	possibly damaging	Het
Rps6kc1	G	T	1: 190,799,958	H616N	probably benign	Het
Slc9b2	T	C	3: 135,336,544	V528A	probably benign	Het
Srgap1	T	C	10: 121,804,921		probably null	Het
Trrap	A	G	5: 144,843,318	T3240A	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Zfhx4	C	A	3: 5,403,345	Y2854*	probably null	Het
Zfp986	C	T	4: 145,898,943	R58C	probably benign	Het

Other mutations in Atad2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Atad2b	APN	12	5024593	missense	probably damaging	1.00
IGL00917:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01011:Atad2b	APN	12	4965984	missense	probably benign	0.01
IGL01092:Atad2b	APN	12	5017987	missense	probably damaging	0.98
IGL01604:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01924:Atad2b	APN	12	5034093	missense	probably damaging	1.00
IGL02197:Atad2b	APN	12	5018056	missense	possibly damaging	0.84
IGL02397:Atad2b	APN	12	4974046	missense	probably damaging	1.00
IGL02404:Atad2b	APN	12	4941972	missense	probably benign	0.08
IGL02517:Atad2b	APN	12	5018037	missense	probably benign	0.07
IGL02726:Atad2b	APN	12	4974003	nonsense	probably null
IGL02896:Atad2b	APN	12	4958151	missense	probably damaging	1.00
IGL03227:Atad2b	APN	12	5006715	missense	probably damaging	1.00
IGL03265:Atad2b	APN	12	5024628	missense	probably benign	0.24
K3955:Atad2b	UTSW	12	4954536	splice site	probably benign
P0038:Atad2b	UTSW	12	4954536	splice site	probably benign
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0124:Atad2b	UTSW	12	4952676	missense	probably benign	0.23
R0462:Atad2b	UTSW	12	4941973	missense	possibly damaging	0.79
R0483:Atad2b	UTSW	12	4945035	splice site	probably benign
R0617:Atad2b	UTSW	12	4937401	missense	probably benign	0.43
R0894:Atad2b	UTSW	12	4965915	missense	probably damaging	1.00
R0942:Atad2b	UTSW	12	5024591	missense	probably damaging	1.00
R0960:Atad2b	UTSW	12	5006593	splice site	probably benign
R0973:Atad2b	UTSW	12	5031784	missense	probably benign	0.00
R1306:Atad2b	UTSW	12	4974239	missense	probably benign	0.08
R1530:Atad2b	UTSW	12	4942018	nonsense	probably null
R1678:Atad2b	UTSW	12	4965899	missense	possibly damaging	0.91
R1689:Atad2b	UTSW	12	5034575	nonsense	probably null
R1826:Atad2b	UTSW	12	4974094	missense	probably benign	0.00
R1996:Atad2b	UTSW	12	4990883	missense	probably benign	0.01
R2233:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2235:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2943:Atad2b	UTSW	12	4942067	missense	probably damaging	0.98
R3161:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3508:Atad2b	UTSW	12	4950595	critical splice donor site	probably null
R4239:Atad2b	UTSW	12	4985710	missense	probably benign	0.05
R4558:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4559:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4573:Atad2b	UTSW	12	4954663	splice site	probably null
R4639:Atad2b	UTSW	12	5018053	missense	probably damaging	1.00
R4847:Atad2b	UTSW	12	4944901	splice site	probably null
R4850:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4851:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4979:Atad2b	UTSW	12	5034513	missense	probably damaging	1.00
R5024:Atad2b	UTSW	12	4937534	missense	probably benign	0.45
R5305:Atad2b	UTSW	12	4965855	missense	probably damaging	1.00
R5405:Atad2b	UTSW	12	4940098	missense	possibly damaging	0.87
R5627:Atad2b	UTSW	12	4917911	missense	probably benign	0.01
R5754:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R6163:Atad2b	UTSW	12	4954593	missense	probably benign	0.00
R6371:Atad2b	UTSW	12	4973970	missense	probably damaging	1.00
R6374:Atad2b	UTSW	12	5018002	missense	probably damaging	1.00
R6399:Atad2b	UTSW	12	4957558	missense	probably damaging	1.00
R6433:Atad2b	UTSW	12	4952642	missense	possibly damaging	0.89
R6546:Atad2b	UTSW	12	4990949	missense	probably damaging	1.00
R6617:Atad2b	UTSW	12	5024668	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAACCCCTTTGAGTGATTTAATAGC -3'
(R):5'- CATGCGTACACTAAAACAGCTG -3'

Sequencing Primer
(F):5'- AGCATACTCTTTTAGTTGGAAATGAC -3'
(R):5'- GCGTACACTAAAACAGCTGAAAAATC -3'

Posted On

2015-07-07