Incidental Mutation 'R4401:Cage1'
ID326643
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Namecancer antigen 1
SynonymsCtag3, 4933427I01Rik, CAGE1
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38006052-38037069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38023102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 256 (I256F)
Ref Sequence ENSEMBL: ENSMUSP00000087278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000089840] [ENSMUST00000110233] [ENSMUST00000131066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074969
AA Change: I362F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: I362F

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089840
AA Change: I256F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087278
Gene: ENSMUSG00000044566
AA Change: I256F

DomainStartEndE-ValueType
Pfam:CAGE1 1 420 6.8e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110233
AA Change: I362F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: I362F

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131066
SMART Domains Protein: ENSMUSP00000122393
Gene: ENSMUSG00000044566

DomainStartEndE-ValueType
Pfam:CAGE1 1 318 6.5e-167 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38022993 nonsense probably null
IGL01736:Cage1 APN 13 38022813 missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38022529 missense probably damaging 1.00
IGL02267:Cage1 APN 13 38023257 missense probably damaging 1.00
IGL03030:Cage1 APN 13 38028147 missense probably benign
IGL03216:Cage1 APN 13 38006177 splice site probably benign
R0487:Cage1 UTSW 13 38025358 missense probably benign 0.00
R0606:Cage1 UTSW 13 38016494 splice site probably benign
R1015:Cage1 UTSW 13 38016475 missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38022880 missense probably damaging 1.00
R1400:Cage1 UTSW 13 38032424 missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38023333 nonsense probably null
R2057:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2058:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2059:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2197:Cage1 UTSW 13 38023053 missense probably damaging 1.00
R3757:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R3758:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38019177 missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38025650 missense probably damaging 1.00
R4402:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4403:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4490:Cage1 UTSW 13 38023417 missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38025501 missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38019208 missense probably benign 0.33
R4950:Cage1 UTSW 13 38023326 missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38023430 missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38011411 nonsense probably null
R5808:Cage1 UTSW 13 38022325 unclassified probably benign
R5845:Cage1 UTSW 13 38015706 missense probably damaging 0.96
R6278:Cage1 UTSW 13 38016419 missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38025449 missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38022558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTTTCCTGTAAGCGCAC -3'
(R):5'- TCAGCTGTGAAGGCTTAGAGC -3'

Sequencing Primer
(F):5'- TCCTGTAAGCGCACGTAATG -3'
(R):5'- GCTTAGAGCCTCTGGAAGAG -3'
Posted On2015-07-07