Mutagenetix > Incidental Mutations

Incidental Mutation 'R4401:Hira'

326647

Institutional Source

Beutler Lab

Gene Symbol

Hira

Ensembl Gene

ENSMUSG00000022702

Gene Name

histone cell cycle regulator

Synonyms

D16Ertd95e, Gm15797, Tuple1

MMRRC Submission

041132-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4401 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18877037-18970309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18925720 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 352 (I352V)

Ref Sequence

ENSEMBL: ENSMUSP00000112614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000120532] [ENSMUST00000153397] [ENSMUST00000190050]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004222
AA Change: I396V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: I396V

Domain	Start	End	E-Value	Type
WD40	1	44	1.56e-1	SMART
WD40	59	98	9.67e-7	SMART
WD40	120	159	3.58e-10	SMART
WD40	163	202	7.22e-6	SMART
WD40	212	254	9.17e1	SMART
WD40	257	313	1.54e0	SMART
WD40	319	356	2.86e0	SMART
low complexity region	405	412	N/A	INTRINSIC
Pfam:HIRA_B	448	470	1.9e-10	PFAM
low complexity region	493	507	N/A	INTRINSIC
low complexity region	540	556	N/A	INTRINSIC
low complexity region	600	614	N/A	INTRINSIC
low complexity region	626	641	N/A	INTRINSIC
Pfam:Hira	761	960	2.9e-61	PFAM
low complexity region	979	989	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120532
AA Change: I352V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000112614
Gene: ENSMUSG00000022702
AA Change: I352V

Domain	Start	End	E-Value	Type
WD40	15	54	9.67e-7	SMART
WD40	76	115	3.58e-10	SMART
WD40	119	158	7.22e-6	SMART
WD40	168	210	9.17e1	SMART
WD40	213	269	1.54e0	SMART
WD40	275	312	2.86e0	SMART
low complexity region	361	368	N/A	INTRINSIC
Pfam:HIRA_B	404	427	1.9e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140748

Predicted Effect

probably benign
Transcript: ENSMUST00000153397

SMART Domains

Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702

Domain	Start	End	E-Value	Type
Blast:WD40	1	40	1e-18	BLAST
SCOP:d1erja_	7	33	3e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190050

SMART Domains

Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

Domain	Start	End	E-Value	Type
low complexity region	26	37	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	A	G	5: 8,702,390	I454V	possibly damaging	Het
Acvr2a	A	G	2: 48,899,702	T486A	probably benign	Het
Ap3b1	C	A	13: 94,418,099	L248I	probably damaging	Het
Atad2b	T	A	12: 4,940,145	C157S	probably damaging	Het
C530008M17Rik	G	A	5: 76,848,916	V74I	probably damaging	Het
Cage1	T	A	13: 38,023,102	I256F	probably damaging	Het
Cct2	A	G	10: 117,057,809	I287T	possibly damaging	Het
Cntn4	A	G	6: 106,489,664	T176A	possibly damaging	Het
Cyp2c54	T	C	19: 40,072,171	N122S	probably benign	Het
Cytip	T	C	2: 58,133,935	D291G	probably benign	Het
Eef1d	C	T	15: 75,902,920	V213I	probably benign	Het
Fnbp4	A	G	2: 90,746,758	T145A	possibly damaging	Het
Fras1	C	A	5: 96,642,620	T951K	probably damaging	Het
Gm11937	C	T	11: 99,610,075	V39M	probably damaging	Het
Gm6712	C	T	17: 17,318,104		noncoding transcript	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Lpcat2	T	C	8: 92,873,055	V217A	possibly damaging	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Olfr1277	A	G	2: 111,269,833	F178S	probably damaging	Het
Olfr447	G	T	6: 42,912,326	E268*	probably null	Het
Olfr561	C	T	7: 102,774,799	R92*	probably null	Het
Pla2g1b	T	A	5: 115,470,888	Y47*	probably null	Het
Pqlc2	T	C	4: 139,306,543	I22V	probably benign	Het
Rfng	A	T	11: 120,782,480	V245E	possibly damaging	Het
Rpf2	A	G	10: 40,236,128	V104A	possibly damaging	Het
Rps6kc1	G	T	1: 190,799,958	H616N	probably benign	Het
Slc9b2	T	C	3: 135,336,544	V528A	probably benign	Het
Srgap1	T	C	10: 121,804,921		probably null	Het
Trrap	A	G	5: 144,843,318	T3240A	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Zfhx4	C	A	3: 5,403,345	Y2854*	probably null	Het
Zfp986	C	T	4: 145,898,943	R58C	probably benign	Het

Other mutations in Hira

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00560:Hira	APN	16	18946340	splice site	probably benign
IGL01285:Hira	APN	16	18912180	missense	probably benign	0.01
F5770:Hira	UTSW	16	18894821	missense	probably damaging	1.00
IGL02796:Hira	UTSW	16	18925654	missense	probably benign	0.01
R0123:Hira	UTSW	16	18956171	missense	probably benign	0.45
R0225:Hira	UTSW	16	18956171	missense	probably benign	0.45
R0606:Hira	UTSW	16	18935047	missense	probably benign	0.00
R1017:Hira	UTSW	16	18899347	intron	probably null
R1456:Hira	UTSW	16	18925663	missense	probably benign	0.02
R1479:Hira	UTSW	16	18896469	missense	probably damaging	1.00
R1731:Hira	UTSW	16	18933014	missense	probably benign	0.01
R1830:Hira	UTSW	16	18947414	missense	probably damaging	1.00
R2039:Hira	UTSW	16	18951701	missense	probably benign	0.05
R4328:Hira	UTSW	16	18896612	missense	probably benign	0.01
R4423:Hira	UTSW	16	18956202	missense	possibly damaging	0.80
R4634:Hira	UTSW	16	18946400	missense	probably damaging	0.98
R4728:Hira	UTSW	16	18922904	missense	probably damaging	1.00
R5050:Hira	UTSW	16	18925859	missense	possibly damaging	0.75
R5139:Hira	UTSW	16	18954758	missense	probably damaging	1.00
R5201:Hira	UTSW	16	18952115	missense	probably damaging	0.98
R5327:Hira	UTSW	16	18954758	missense	probably damaging	1.00
R5483:Hira	UTSW	16	18969540	missense	possibly damaging	0.89
R5573:Hira	UTSW	16	18916599	missense	probably damaging	1.00
R5626:Hira	UTSW	16	18927512	missense	probably damaging	0.97
R5768:Hira	UTSW	16	18935018	splice site	probably benign
R5952:Hira	UTSW	16	18935065	missense	possibly damaging	0.83
R6128:Hira	UTSW	16	18932977	missense	probably benign	0.08
R6280:Hira	UTSW	16	18910707	missense	probably damaging	1.00
V7581:Hira	UTSW	16	18894821	missense	probably damaging	1.00
V7582:Hira	UTSW	16	18894821	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTCTAGTCAGCGACTGGC -3'
(R):5'- TTTAGTGCCACTGGACCATG -3'

Sequencing Primer
(F):5'- GAGCTGGCCTCCTGAGCTATTC -3'
(R):5'- TGGACCATGCCCTCACC -3'

Posted On

2015-07-07