Incidental Mutation 'R4402:Rps6kc1'
ID326655
Institutional Source Beutler Lab
Gene Symbol Rps6kc1
Ensembl Gene ENSMUSG00000089872
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRPK118
MMRRC Submission 042003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4402 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location190700202-190911770 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 190798605 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000061611] [ENSMUST00000159367] [ENSMUST00000159624]
Predicted Effect probably benign
Transcript: ENSMUST00000061611
SMART Domains Protein: ENSMUSP00000061769
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
MIT 235 313 1.12e-20 SMART
low complexity region 317 332 N/A INTRINSIC
SCOP:d1apme_ 347 417 2e-5 SMART
low complexity region 443 454 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Pfam:Pkinase 863 1046 4.4e-26 PFAM
Pfam:Pkinase_Tyr 876 1032 5.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159367
SMART Domains Protein: ENSMUSP00000124383
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
Blast:PX 9 50 4e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159624
SMART Domains Protein: ENSMUSP00000125010
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Pfam:MIT 238 299 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159823
Predicted Effect probably benign
Transcript: ENSMUST00000160889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162500
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,194 H167Q probably benign Het
Adamts20 T C 15: 94,379,946 T212A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atl1 T G 12: 69,959,199 D426E probably benign Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Calcr A T 6: 3,708,484 probably null Het
Canx T C 11: 50,304,438 T268A probably benign Het
Chd7 A T 4: 8,866,353 M842L possibly damaging Het
Clca4a T C 3: 144,952,848 T787A probably benign Het
Clstn3 T C 6: 124,456,980 Y407C probably damaging Het
Copa C A 1: 172,102,224 T286N probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Def6 A G 17: 28,219,976 K219E probably damaging Het
Eif4g1 G T 16: 20,678,843 probably benign Het
Eif5 A T 12: 111,541,749 K161N probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gen1 A T 12: 11,242,362 N475K possibly damaging Het
Gm14569 T C X: 36,433,493 Y521C probably benign Het
Gm6124 T A 7: 39,221,105 noncoding transcript Het
Gpt2 A T 8: 85,525,559 D501V probably benign Het
Gstm2 T C 3: 107,986,054 K31R probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Itga1 T A 13: 115,001,566 M428L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnn4 T C 7: 24,377,442 W139R probably benign Het
Kdm7a T A 6: 39,166,668 R380W probably null Het
Khdrbs1 T G 4: 129,742,096 D22A possibly damaging Het
Liph A T 16: 21,976,250 I204N probably damaging Het
Loxhd1 A G 18: 77,441,760 E2033G possibly damaging Het
M6pr C T 6: 122,315,023 probably benign Het
Mrm1 A G 11: 84,819,089 I95T probably damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Mug1 C A 6: 121,879,352 F1030L probably damaging Het
Naca C T 10: 128,043,472 probably benign Het
Nob1 A T 8: 107,418,488 probably benign Het
Nutm1 A C 2: 112,249,809 I587R probably damaging Het
Olfr385 A G 11: 73,589,255 V161A probably benign Het
Pcdhb2 A G 18: 37,295,402 K143E probably benign Het
Pcnt T C 10: 76,392,393 Q1646R probably benign Het
Piwil2 A T 14: 70,408,916 D390E probably benign Het
Pkhd1 A G 1: 20,239,411 L2771P probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Plekhn1 T C 4: 156,225,356 T135A probably damaging Het
Pola1 T C X: 93,561,423 Y968C probably damaging Het
Ppp1r26 C A 2: 28,451,606 T416K probably benign Het
Psmd1 A G 1: 86,075,951 I153V possibly damaging Het
Rcan2 A G 17: 43,953,470 D7G probably benign Het
Rexo5 T C 7: 119,834,376 I326T possibly damaging Het
Shc1 T C 3: 89,426,678 S273P probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Tas2r118 T C 6: 23,969,294 K256R probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tnfaip2 T C 12: 111,449,851 F516L probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Wdr35 A G 12: 8,989,981 D362G probably damaging Het
Wwp2 T C 8: 107,457,978 V106A probably benign Het
Zfp40 T A 17: 23,176,719 H230L possibly damaging Het
Zkscan17 T A 11: 59,503,022 M1L possibly damaging Het
Other mutations in Rps6kc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rps6kc1 APN 1 190773678 missense probably damaging 1.00
IGL01310:Rps6kc1 APN 1 190783625 missense probably benign 0.45
IGL01331:Rps6kc1 APN 1 190800352 missense possibly damaging 0.49
IGL01551:Rps6kc1 APN 1 190773640 missense possibly damaging 0.70
IGL01665:Rps6kc1 APN 1 190911657 missense possibly damaging 0.66
IGL02178:Rps6kc1 APN 1 190871836 missense possibly damaging 0.63
IGL02550:Rps6kc1 APN 1 190871862 missense probably damaging 1.00
IGL02986:Rps6kc1 APN 1 190834061 missense probably damaging 1.00
IGL03010:Rps6kc1 APN 1 190911606 nonsense probably null
IGL03087:Rps6kc1 APN 1 190871711 missense probably damaging 1.00
IGL03130:Rps6kc1 APN 1 190799811 missense probably damaging 1.00
IGL03264:Rps6kc1 APN 1 190871829 missense probably benign
IGL03386:Rps6kc1 APN 1 190799570 missense probably damaging 0.97
R0184:Rps6kc1 UTSW 1 190799093 missense probably null 1.00
R0280:Rps6kc1 UTSW 1 190809000 missense probably damaging 1.00
R0482:Rps6kc1 UTSW 1 190799430 missense probably benign 0.00
R0651:Rps6kc1 UTSW 1 190799496 missense possibly damaging 0.51
R0785:Rps6kc1 UTSW 1 190808945 missense probably damaging 1.00
R1398:Rps6kc1 UTSW 1 190800015 missense probably damaging 0.99
R1428:Rps6kc1 UTSW 1 190798726 missense probably damaging 1.00
R1484:Rps6kc1 UTSW 1 190799475 missense possibly damaging 0.63
R1536:Rps6kc1 UTSW 1 190871768 missense possibly damaging 0.89
R1709:Rps6kc1 UTSW 1 190800336 missense possibly damaging 0.72
R2060:Rps6kc1 UTSW 1 190810108 missense possibly damaging 0.94
R2153:Rps6kc1 UTSW 1 190798723 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R4177:Rps6kc1 UTSW 1 190800419 missense possibly damaging 0.92
R4231:Rps6kc1 UTSW 1 190808900 missense probably damaging 1.00
R4401:Rps6kc1 UTSW 1 190799958 missense probably benign 0.32
R4785:Rps6kc1 UTSW 1 190750188 missense probably benign 0.00
R4810:Rps6kc1 UTSW 1 190808963 missense probably damaging 1.00
R4858:Rps6kc1 UTSW 1 190800318 missense probably damaging 1.00
R4887:Rps6kc1 UTSW 1 190798694 missense probably benign 0.13
R4976:Rps6kc1 UTSW 1 190798727 missense probably damaging 0.99
R5134:Rps6kc1 UTSW 1 190773648 missense probably damaging 1.00
R5217:Rps6kc1 UTSW 1 190783605 missense probably damaging 1.00
R5350:Rps6kc1 UTSW 1 190799466 missense probably benign
R5952:Rps6kc1 UTSW 1 190885420 missense probably benign 0.05
R5979:Rps6kc1 UTSW 1 190800435 missense probably damaging 1.00
R6597:Rps6kc1 UTSW 1 190750184 missense probably benign 0.20
R7024:Rps6kc1 UTSW 1 190800210 missense probably benign 0.00
R7192:Rps6kc1 UTSW 1 190800359 missense probably damaging 0.98
R7423:Rps6kc1 UTSW 1 190799096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTCCTTAAGACACTTCAAAG -3'
(R):5'- GAGTAATTACAGTTCGCTTCTGC -3'

Sequencing Primer
(F):5'- TCAAAGAACACAATGAGTTTCCAGAG -3'
(R):5'- CAGTTCGCTTCTGCAGAAAATGG -3'
Posted On2015-07-07