Incidental Mutation 'R4403:Calcr'
ID326721
Institutional Source Beutler Lab
Gene Symbol Calcr
Ensembl Gene ENSMUSG00000023964
Gene Namecalcitonin receptor
SynonymsClr
MMRRC Submission 041687-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4403 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3685680-3764714 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 3708484 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075644] [ENSMUST00000115622] [ENSMUST00000168592] [ENSMUST00000170266] [ENSMUST00000171613]
Predicted Effect probably null
Transcript: ENSMUST00000075644
SMART Domains Protein: ENSMUSP00000075070
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 5.2e-85 PFAM
Pfam:Dicty_CAR 259 410 5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115622
SMART Domains Protein: ENSMUSP00000111285
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168592
SMART Domains Protein: ENSMUSP00000130243
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170266
SMART Domains Protein: ENSMUSP00000132124
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 441 2.2e-84 PFAM
Pfam:Dicty_CAR 257 399 2.5e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171396
Predicted Effect probably null
Transcript: ENSMUST00000171613
SMART Domains Protein: ENSMUSP00000130083
Gene: ENSMUSG00000023964

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
HormR 85 160 4.33e-32 SMART
Pfam:7tm_2 162 404 1.1e-85 PFAM
Meta Mutation Damage Score 0.544 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Haploinsufficiency may result in increased bone density due to increased bone formation. Homozygous inactivation may result in embryonic lethality. Mice homozygous for another disruption allele at this locus show a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,436 Y2037C probably damaging Het
Adam33 T C 2: 131,053,270 T647A probably benign Het
Adamts9 C T 6: 92,859,864 A636T probably damaging Het
Aldh3b2 A T 19: 3,980,059 I348F probably damaging Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Btbd9 A G 17: 30,485,932 probably benign Het
C2cd3 A G 7: 100,432,099 R1361G probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cbr2 T A 11: 120,730,802 N83I probably damaging Het
Crb1 T C 1: 139,248,379 N561S probably benign Het
Dpp6 T A 5: 27,718,462 L690Q probably damaging Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Enthd1 A G 15: 80,452,824 S470P probably benign Het
Fat3 T C 9: 15,944,873 Y3871C probably damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gosr1 T C 11: 76,754,735 E73G possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Kcnk15 A G 2: 163,858,618 N259S probably damaging Het
Kdm5d G T Y: 899,830 R132L probably damaging Het
Med21 C T 6: 146,649,182 R64* probably null Het
Mgea5 A T 19: 45,778,639 D99E probably damaging Het
Muc19 A T 15: 91,871,570 noncoding transcript Het
Nlrp4e T A 7: 23,321,463 C458* probably null Het
Obscn T C 11: 59,069,093 Q3525R possibly damaging Het
Phf3 A G 1: 30,804,409 L1823S probably damaging Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Prmt3 T A 7: 49,780,357 H69Q probably damaging Het
Rcor3 T C 1: 192,119,912 probably null Het
Rhoa T A 9: 108,336,814 I192N probably benign Het
Sbf1 T C 15: 89,293,954 I1532V possibly damaging Het
Scn11a T C 9: 119,795,667 T530A probably damaging Het
Slc26a6 T C 9: 108,855,938 F39L probably benign Het
Tfpi A T 2: 84,444,862 M134K probably damaging Het
Other mutations in Calcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Calcr APN 6 3717196 missense probably damaging 1.00
IGL01146:Calcr APN 6 3700144 missense possibly damaging 0.88
IGL02253:Calcr APN 6 3707523 missense probably benign 0.12
IGL02567:Calcr APN 6 3691564 missense probably damaging 1.00
IGL02729:Calcr APN 6 3707595 missense probably benign
IGL03062:Calcr APN 6 3693718 missense probably benign 0.08
R0111:Calcr UTSW 6 3717157 missense probably damaging 1.00
R0561:Calcr UTSW 6 3692630 missense probably damaging 0.99
R1013:Calcr UTSW 6 3692621 missense probably damaging 1.00
R1628:Calcr UTSW 6 3700251 missense possibly damaging 0.53
R2152:Calcr UTSW 6 3687615 missense probably benign 0.03
R2206:Calcr UTSW 6 3717133 missense probably damaging 0.98
R2207:Calcr UTSW 6 3717133 missense probably damaging 0.98
R3403:Calcr UTSW 6 3687604 missense probably benign 0.04
R3781:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3782:Calcr UTSW 6 3700193 missense possibly damaging 0.93
R3851:Calcr UTSW 6 3693735 missense probably damaging 1.00
R3852:Calcr UTSW 6 3693735 missense probably damaging 1.00
R4190:Calcr UTSW 6 3717106 missense possibly damaging 0.82
R4387:Calcr UTSW 6 3707581 missense probably damaging 0.98
R4402:Calcr UTSW 6 3708484 critical splice donor site probably null
R4494:Calcr UTSW 6 3708484 critical splice donor site probably null
R4495:Calcr UTSW 6 3708484 critical splice donor site probably null
R4745:Calcr UTSW 6 3692576 missense probably damaging 0.99
R4857:Calcr UTSW 6 3708511 missense probably benign 0.29
R4883:Calcr UTSW 6 3714705 missense probably damaging 1.00
R5168:Calcr UTSW 6 3708610 missense probably benign 0.00
R5375:Calcr UTSW 6 3714651 missense probably benign 0.00
R5643:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5644:Calcr UTSW 6 3708538 missense probably damaging 1.00
R5688:Calcr UTSW 6 3714730 synonymous probably null
R5799:Calcr UTSW 6 3707592 missense probably benign 0.13
R5920:Calcr UTSW 6 3722994 missense probably damaging 0.97
R6249:Calcr UTSW 6 3692711 missense possibly damaging 0.49
R6329:Calcr UTSW 6 3687621 missense probably damaging 1.00
R6357:Calcr UTSW 6 3714710 missense probably benign 0.00
R6365:Calcr UTSW 6 3711455 missense probably benign 0.00
R6393:Calcr UTSW 6 3708586 missense probably damaging 1.00
R6547:Calcr UTSW 6 3717177 missense probably damaging 1.00
R7034:Calcr UTSW 6 3692543 missense probably damaging 1.00
R7208:Calcr UTSW 6 3687612 missense probably benign 0.00
R7342:Calcr UTSW 6 3691536 missense probably benign 0.03
R7430:Calcr UTSW 6 3708586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATTGTGGAGCACTGGTAC -3'
(R):5'- TCGTGTAACAACCCTTTGTGC -3'

Sequencing Primer
(F):5'- TGATAAATTATTGGGTAGCCATAAGC -3'
(R):5'- GTGTAACAACCCTTTGTGCTTTCATG -3'
Posted On2015-07-07