Incidental Mutation 'R4404:Fer'
ID326771
Institutional Source Beutler Lab
Gene Symbol Fer
Ensembl Gene ENSMUSG00000000127
Gene Namefer (fms/fps related) protein kinase
SynonymsFert, Fert2
MMRRC Submission 041133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4404 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location63896018-64139494 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 63941289 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000129] [ENSMUST00000038080]
Predicted Effect probably null
Transcript: ENSMUST00000000129
SMART Domains Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127

DomainStartEndE-ValueType
FCH 1 92 1.29e-27 SMART
coiled coil region 123 174 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
coiled coil region 308 381 N/A INTRINSIC
SH2 459 538 5.9e-30 SMART
TyrKc 564 815 6.69e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000038080
SMART Domains Protein: ENSMUSP00000037418
Gene: ENSMUSG00000000127

DomainStartEndE-ValueType
SH2 89 168 5.9e-30 SMART
TyrKc 194 445 6.69e-148 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C87414 T A 5: 93,637,713 H236L possibly damaging Het
Ccdc188 A G 16: 18,218,420 Q153R probably damaging Het
Dopey1 T A 9: 86,522,813 L1721* probably null Het
Fuk T A 8: 110,890,301 T406S probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Gria4 A T 9: 4,464,489 probably null Het
Gtf3c4 T C 2: 28,826,749 D813G probably damaging Het
Hars2 G T 18: 36,785,936 C83F probably damaging Het
Htr6 A G 4: 139,062,202 S251P probably benign Het
Igsf10 T C 3: 59,329,551 T1070A probably benign Het
Il22ra1 A T 4: 135,737,431 E149D possibly damaging Het
Lama3 G A 18: 12,582,531 M1681I probably benign Het
Loxhd1 G A 18: 77,431,132 G1878D probably damaging Het
Mcc G A 18: 44,759,298 T83M probably benign Het
Nol11 A T 11: 107,173,725 C468S probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Npy5r C T 8: 66,681,992 V50I probably benign Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pam T C 1: 97,854,721 probably benign Het
Pank4 C T 4: 154,980,156 T724I probably benign Het
Pifo G A 3: 106,001,368 P7L probably benign Het
Sertm1 C T 3: 54,899,325 C93Y probably damaging Het
Slc22a2 A G 17: 12,614,764 T444A probably damaging Het
Trpm7 C A 2: 126,833,715 L489F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn2r76 T C 7: 86,228,303 T511A probably benign Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Fer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Fer APN 17 64037626 missense probably damaging 1.00
IGL02004:Fer APN 17 63924179 critical splice donor site probably null
IGL02103:Fer APN 17 64138928 missense probably benign 0.02
IGL02157:Fer APN 17 64138899 missense probably benign 0.03
IGL02217:Fer APN 17 64138965 missense probably benign 0.00
IGL02376:Fer APN 17 63934346 missense possibly damaging 0.69
IGL02955:Fer APN 17 63991717 critical splice donor site probably null
IGL02967:Fer APN 17 63896267 missense possibly damaging 0.69
IGL03392:Fer APN 17 63991642 missense probably damaging 0.97
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0207:Fer UTSW 17 63896278 missense probably damaging 1.00
R0243:Fer UTSW 17 64078946 missense probably benign 0.00
R0309:Fer UTSW 17 64139016 makesense probably null
R0384:Fer UTSW 17 63924184 splice site probably benign
R0634:Fer UTSW 17 64035508 missense probably benign 0.40
R1885:Fer UTSW 17 64138914 missense probably damaging 0.96
R1939:Fer UTSW 17 63973128 missense probably damaging 1.00
R2427:Fer UTSW 17 63957303 missense probably benign
R2504:Fer UTSW 17 63991580 splice site probably null
R4301:Fer UTSW 17 64078910 missense probably damaging 1.00
R4418:Fer UTSW 17 64029291 missense possibly damaging 0.89
R4812:Fer UTSW 17 63934297 missense probably benign
R5561:Fer UTSW 17 64037585 nonsense probably null
R5724:Fer UTSW 17 63924157 missense probably damaging 1.00
R5936:Fer UTSW 17 63924063 missense probably benign
R6157:Fer UTSW 17 64078885 missense probably damaging 1.00
R6848:Fer UTSW 17 63991606 missense probably damaging 1.00
R7175:Fer UTSW 17 63924095 missense probably benign 0.01
R7198:Fer UTSW 17 63921688 missense possibly damaging 0.84
R7438:Fer UTSW 17 64133521 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATTCTGAAGGAGTGCTGTAGAG -3'
(R):5'- TCCGCAGCTTACCATGGATG -3'

Sequencing Primer
(F):5'- TAATCTGCATAGACACACGAACACG -3'
(R):5'- CAGCTTACCATGGATGTGACTGAC -3'
Posted On2015-07-07