Incidental Mutation 'R4415:B020004C17Rik'
List |< first << previous [record 77 of 958] next >> last >|
ID326810
Institutional Source Beutler Lab
Gene Symbol B020004C17Rik
Ensembl Gene ENSMUSG00000096144
Gene NameRIKEN cDNA B020004C17 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57015134-57018982 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 57017417 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 233 (*233R)
Ref Sequence ENSEMBL: ENSMUSP00000137042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178161]
Predicted Effect probably null
Transcript: ENSMUST00000178161
AA Change: *233R
SMART Domains Protein: ENSMUSP00000137042
Gene: ENSMUSG00000096144
AA Change: *233R

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225045
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in B020004C17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:B020004C17Rik APN 14 57016023 missense probably damaging 0.96
IGL03396:B020004C17Rik APN 14 57016536 missense possibly damaging 0.61
R0664:B020004C17Rik UTSW 14 57016768 missense possibly damaging 0.56
R3977:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3978:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3979:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R5290:B020004C17Rik UTSW 14 57016579 missense possibly damaging 0.94
R5479:B020004C17Rik UTSW 14 57016542 missense probably benign 0.36
R5651:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5655:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5736:B020004C17Rik UTSW 14 57017366 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGAACCCATCGCTGATGATG -3'
(R):5'- GAGAGTTTAGCCTCAGGGTCAG -3'

Sequencing Primer
(F):5'- CATCGCTGATGATGTCCAGTCAG -3'
(R):5'- GTTTAGCCTCAGGGTCAGAAATC -3'
Posted On2015-07-07