Incidental Mutation 'R4417:Tlr4'
ID326874
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 041138-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66839303 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 111 (N111I)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000048096
AA Change: N111I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: N111I

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E129G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 E109D probably benign Het
Glp2r T C 11: 67,664,516 E271G probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably benign
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably benign
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCTGCAGAGTTCCTCTCCTG -3'
(R):5'- CCACATGTACTAGGTTCGTCAG -3'

Sequencing Primer
(F):5'- ATCACCTGTTTTGCTCTGTACAG -3'
(R):5'- CACATGTACTAGGTTCGTCAGATTGG -3'
Posted OnJul 07, 2015