Incidental Mutation 'R0016:Stag3'
ID32689
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Namestromal antigen 3
SynonymsSA-2, stromalin 3
MMRRC Submission 038311-MU
Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location138280240-138312393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138291381 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 271 (H271R)
Ref Sequence ENSEMBL: ENSMUSP00000125523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000160729] [ENSMUST00000161691] [ENSMUST00000162245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048028
AA Change: H271R

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: H271R

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect probably benign
Transcript: ENSMUST00000160729
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000161691
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162245
AA Change: H271R

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: H271R

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138299138 missense probably damaging 1.00
IGL00336:Stag3 APN 5 138297659 missense probably benign 0.42
IGL00514:Stag3 APN 5 138300135 missense probably damaging 1.00
IGL00961:Stag3 APN 5 138298349 missense probably benign 0.01
IGL01923:Stag3 APN 5 138289230 missense probably damaging 1.00
IGL02252:Stag3 APN 5 138302548 missense probably damaging 1.00
IGL02424:Stag3 APN 5 138281985 nonsense probably null
IGL02424:Stag3 APN 5 138291366 missense probably damaging 1.00
IGL02869:Stag3 APN 5 138282693 missense probably damaging 0.96
thor UTSW 5 138301036 critical splice donor site probably null
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R1455:Stag3 UTSW 5 138311735 missense probably benign 0.00
R1512:Stag3 UTSW 5 138297985 missense probably benign 0.32
R1530:Stag3 UTSW 5 138297412 missense probably damaging 0.99
R1608:Stag3 UTSW 5 138298639 intron probably null
R1736:Stag3 UTSW 5 138304509 splice site probably benign
R1969:Stag3 UTSW 5 138300138 missense probably damaging 0.99
R2034:Stag3 UTSW 5 138298001 missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138301266 missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138298284 missense probably damaging 1.00
R2411:Stag3 UTSW 5 138283028 splice site probably benign
R3792:Stag3 UTSW 5 138298349 missense probably benign 0.01
R3887:Stag3 UTSW 5 138298839 missense probably damaging 0.99
R4255:Stag3 UTSW 5 138290881 missense probably damaging 0.98
R4777:Stag3 UTSW 5 138309199 unclassified probably benign
R4842:Stag3 UTSW 5 138309365 intron probably null
R4854:Stag3 UTSW 5 138296694 splice site probably null
R5045:Stag3 UTSW 5 138304478 missense probably damaging 1.00
R5631:Stag3 UTSW 5 138295877 missense probably damaging 0.96
R5729:Stag3 UTSW 5 138290223 missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138298838 missense probably damaging 0.99
R6004:Stag3 UTSW 5 138289206 missense probably damaging 1.00
R6172:Stag3 UTSW 5 138299843 missense probably benign 0.41
R6503:Stag3 UTSW 5 138304420 missense probably damaging 0.96
R6545:Stag3 UTSW 5 138298352 missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138301499 missense probably damaging 0.98
R6861:Stag3 UTSW 5 138304707 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACTTCAGAGTCACCCTGCTTGTTG -3'
(R):5'- AGTGCAGGAACATTGTTGCTACCC -3'

Sequencing Primer
(F):5'- CTCTGACTTGAACAACGGCT -3'
(R):5'- CCTGTGCTCACTGAGAGAAG -3'
Posted On2013-05-09