Incidental Mutation 'R4417:Rdh14'
ID326898
Institutional Source Beutler Lab
Gene Symbol Rdh14
Ensembl Gene ENSMUSG00000020621
Gene Nameretinol dehydrogenase 14 (all-trans and 9-cis)
SynonymsPAN2
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R4417 (G1)
Quality Score153
Status Validated
Chromosome12
Chromosomal Location10390772-10395562 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 10391231 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002456] [ENSMUST00000020947] [ENSMUST00000118657] [ENSMUST00000147323] [ENSMUST00000217944] [ENSMUST00000218026] [ENSMUST00000218287] [ENSMUST00000218327] [ENSMUST00000218339] [ENSMUST00000218417] [ENSMUST00000218551] [ENSMUST00000219049] [ENSMUST00000219292] [ENSMUST00000219826] [ENSMUST00000220257] [ENSMUST00000220611] [ENSMUST00000223534]
Predicted Effect probably benign
Transcript: ENSMUST00000002456
SMART Domains Protein: ENSMUSP00000002456
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 570 1.6e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020947
SMART Domains Protein: ENSMUSP00000020947
Gene: ENSMUSG00000020621

DomainStartEndE-ValueType
transmembrane domain 2 21 N/A INTRINSIC
Pfam:KR 45 199 3.4e-10 PFAM
Pfam:adh_short 45 258 5.4e-34 PFAM
Pfam:Epimerase 47 248 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118657
SMART Domains Protein: ENSMUSP00000112694
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 91 103 N/A INTRINSIC
low complexity region 135 143 N/A INTRINSIC
low complexity region 225 231 N/A INTRINSIC
Pfam:5-nucleotidase 280 553 7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147323
SMART Domains Protein: ENSMUSP00000117869
Gene: ENSMUSG00000020622

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 137 145 N/A INTRINSIC
low complexity region 227 233 N/A INTRINSIC
Pfam:5-nucleotidase 298 466 4.8e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217944
Predicted Effect probably benign
Transcript: ENSMUST00000218026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218148
Predicted Effect probably benign
Transcript: ENSMUST00000218287
Predicted Effect probably benign
Transcript: ENSMUST00000218288
Predicted Effect probably benign
Transcript: ENSMUST00000218327
Predicted Effect probably benign
Transcript: ENSMUST00000218339
Predicted Effect probably benign
Transcript: ENSMUST00000218417
Predicted Effect probably benign
Transcript: ENSMUST00000218551
Predicted Effect probably benign
Transcript: ENSMUST00000219049
Predicted Effect probably benign
Transcript: ENSMUST00000219292
Predicted Effect probably benign
Transcript: ENSMUST00000219630
Predicted Effect probably benign
Transcript: ENSMUST00000219826
Predicted Effect probably benign
Transcript: ENSMUST00000220257
Predicted Effect probably benign
Transcript: ENSMUST00000220611
Predicted Effect probably benign
Transcript: ENSMUST00000223534
Meta Mutation Damage Score 0.6084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Rdh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Rdh14 APN 12 10391134 missense probably damaging 0.98
IGL00928:Rdh14 APN 12 10394803 missense probably damaging 1.00
IGL02207:Rdh14 APN 12 10394712 missense possibly damaging 0.81
H8562:Rdh14 UTSW 12 10394709 missense probably damaging 1.00
R1521:Rdh14 UTSW 12 10394613 missense probably damaging 1.00
R1943:Rdh14 UTSW 12 10391162 missense probably benign 0.09
R3980:Rdh14 UTSW 12 10394703 missense probably benign 0.04
R4289:Rdh14 UTSW 12 10394949 missense probably benign 0.00
R4414:Rdh14 UTSW 12 10391231 splice site probably null
R4415:Rdh14 UTSW 12 10391231 splice site probably null
R4594:Rdh14 UTSW 12 10394567 missense probably damaging 1.00
R5397:Rdh14 UTSW 12 10394869 missense probably damaging 0.99
R6618:Rdh14 UTSW 12 10395123 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGATCACCGGAGCAAACAGC -3'
(R):5'- CAGACACTGGCTTATTTATGCAC -3'

Sequencing Primer
(F):5'- GCGCGGGTCATCATGGG -3'
(R):5'- ACTTCTCCTTAGGACCTCCCAGG -3'
Posted On2015-07-07