Incidental Mutation 'R4417:BC004004'
ID326904
Institutional Source Beutler Lab
Gene Symbol BC004004
Ensembl Gene ENSMUSG00000052712
Gene NamecDNA sequence BC004004
Synonyms
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29268788-29302881 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 29282275 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064709] [ENSMUST00000120346] [ENSMUST00000149405]
Predicted Effect probably benign
Transcript: ENSMUST00000064709
SMART Domains Protein: ENSMUSP00000066224
Gene: ENSMUSG00000052712

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120346
SMART Domains Protein: ENSMUSP00000113315
Gene: ENSMUSG00000052712

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149405
SMART Domains Protein: ENSMUSP00000117309
Gene: ENSMUSG00000052712

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 222 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156215
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in BC004004
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:BC004004 APN 17 29282251 missense probably damaging 1.00
IGL01454:BC004004 APN 17 29294021 missense possibly damaging 0.76
IGL02437:BC004004 APN 17 29298697 missense probably damaging 0.99
R0677:BC004004 UTSW 17 29298664 missense probably damaging 1.00
R1440:BC004004 UTSW 17 29296691 critical splice donor site probably null
R3744:BC004004 UTSW 17 29301449 makesense probably null
R4017:BC004004 UTSW 17 29298732 missense probably damaging 0.98
R4883:BC004004 UTSW 17 29282192 missense probably damaging 1.00
R5071:BC004004 UTSW 17 29294415 critical splice donor site probably null
R5619:BC004004 UTSW 17 29282729 missense probably damaging 1.00
R5768:BC004004 UTSW 17 29282735 missense probably damaging 1.00
R5846:BC004004 UTSW 17 29282308 intron probably benign
R6259:BC004004 UTSW 17 29298712 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGATCTTGCTGCTAATGAGATCAG -3'
(R):5'- AGTTTTCATCCCGCTGCCAG -3'

Sequencing Primer
(F):5'- GCTGCTAATGAGATCAGCATCTATG -3'
(R):5'- AGGTGCTACGCCCACTAC -3'
Posted On2015-07-07