Incidental Mutation 'R4418:Kcnk2'
ID326912
Institutional Source Beutler Lab
Gene Symbol Kcnk2
Ensembl Gene ENSMUSG00000037624
Gene Namepotassium channel, subfamily K, member 2
SynonymsTREK-1
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location189207930-189402273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 189256727 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 207 (R207C)
Ref Sequence ENSEMBL: ENSMUSP00000141849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079451] [ENSMUST00000110920] [ENSMUST00000180044] [ENSMUST00000192723] [ENSMUST00000193319] [ENSMUST00000194172] [ENSMUST00000194402]
Predicted Effect probably damaging
Transcript: ENSMUST00000079451
AA Change: R210C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078416
Gene: ENSMUSG00000037624
AA Change: R210C

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 197 2e-20 PFAM
low complexity region 221 230 N/A INTRINSIC
Pfam:Ion_trans_2 233 313 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110920
AA Change: R207C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106545
Gene: ENSMUSG00000037624
AA Change: R207C

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180044
SMART Domains Protein: ENSMUSP00000136513
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192723
AA Change: R207C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141849
Gene: ENSMUSG00000037624
AA Change: R207C

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193319
AA Change: R222C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141891
Gene: ENSMUSG00000037624
AA Change: R222C

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 198 2.5e-21 PFAM
Pfam:Ion_trans_2 226 313 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194172
SMART Domains Protein: ENSMUSP00000142176
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 5e-20 PFAM
low complexity region 216 231 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194402
AA Change: R218C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142026
Gene: ENSMUSG00000037624
AA Change: R218C

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 1.4e-19 PFAM
Pfam:Ion_trans_2 222 309 2.2e-19 PFAM
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased sensitivity to pharmacologically induced seizures and ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Kcnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnk2 APN 1 189243014 missense probably damaging 0.96
IGL01100:Kcnk2 APN 1 189339936 missense probably damaging 1.00
IGL01872:Kcnk2 APN 1 189256583 missense probably damaging 1.00
IGL01929:Kcnk2 APN 1 189340030 missense probably damaging 1.00
IGL02643:Kcnk2 APN 1 189258779 missense possibly damaging 0.63
IGL03056:Kcnk2 APN 1 189295711 missense possibly damaging 0.82
IGL03340:Kcnk2 APN 1 189295681 missense possibly damaging 0.51
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0279:Kcnk2 UTSW 1 189209972 missense possibly damaging 0.58
R0569:Kcnk2 UTSW 1 189339801 missense probably damaging 1.00
R0645:Kcnk2 UTSW 1 189256730 intron probably null
R1070:Kcnk2 UTSW 1 189256763 splice site probably benign
R1449:Kcnk2 UTSW 1 189340026 missense probably benign 0.31
R2401:Kcnk2 UTSW 1 189340017 missense possibly damaging 0.64
R4923:Kcnk2 UTSW 1 189339936 missense probably damaging 1.00
R5782:Kcnk2 UTSW 1 189256579 missense probably damaging 1.00
R5845:Kcnk2 UTSW 1 189277721 intron probably benign
R6140:Kcnk2 UTSW 1 189209907 missense probably damaging 0.97
R6240:Kcnk2 UTSW 1 189242982 missense probably damaging 1.00
R6881:Kcnk2 UTSW 1 189209990 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTACCTGCCACGTAG -3'
(R):5'- TGAAGAAAACATTTTACCCGTGGG -3'

Sequencing Primer
(F):5'- GTAGTCTCCAAATCCAATGGTCG -3'
(R):5'- GTCGTTCTGGCTTATTTACAGTATAC -3'
Posted On2015-07-07