Incidental Mutation 'R4418:Dclre1c'
ID326915
Institutional Source Beutler Lab
Gene Symbol Dclre1c
Ensembl Gene ENSMUSG00000026648
Gene NameDNA cross-link repair 1C
SynonymsArtemis, Art, 9930121L06Rik
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3424131-3464130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3452935 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 285 (F285S)
Ref Sequence ENSEMBL: ENSMUSP00000110718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027956] [ENSMUST00000060618] [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000102988] [ENSMUST00000115066] [ENSMUST00000127540]
Predicted Effect probably benign
Transcript: ENSMUST00000027956
SMART Domains Protein: ENSMUSP00000027956
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
CHROMO 117 169 2.44e-11 SMART
Pfam:Pre-SET 212 309 4.4e-18 PFAM
SET 317 446 4.05e-41 SMART
PostSET 461 477 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060618
SMART Domains Protein: ENSMUSP00000054169
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
SET 70 226 6.61e-23 SMART
PostSET 241 257 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061852
AA Change: F415S

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648
AA Change: F415S

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100458
SMART Domains Protein: ENSMUSP00000098026
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
CHROMO 6 67 2e-7 SMART
Pfam:Pre-SET 110 207 1.3e-17 PFAM
SET 215 344 4.05e-41 SMART
PostSET 359 375 7.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100463
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102988
AA Change: F415S

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100053
Gene: ENSMUSG00000026648
AA Change: F415S

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 8.8e-23 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
internal_repeat_1 518 534 4.97e-8 PROSPERO
internal_repeat_1 525 541 4.97e-8 PROSPERO
low complexity region 545 559 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115066
AA Change: F285S

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648
AA Change: F285S

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127540
SMART Domains Protein: ENSMUSP00000125485
Gene: ENSMUSG00000026646

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129657
SMART Domains Protein: ENSMUSP00000116883
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Pfam:DRMBL 1 96 1.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152468
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Dclre1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Dclre1c APN 2 3433784 nonsense probably null
IGL02165:Dclre1c APN 2 3450381 splice site probably benign
IGL02955:Dclre1c APN 2 3438052 missense probably damaging 1.00
IGL02961:Dclre1c APN 2 3437033 missense probably damaging 1.00
Chairy UTSW 2 3452863 missense probably damaging 1.00
kiwis UTSW 2 3436475 missense probably damaging 1.00
pee-wee UTSW 2 3437705 missense probably damaging 1.00
western_woods UTSW 2 3453169 missense possibly damaging 0.68
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0520:Dclre1c UTSW 2 3436475 missense probably damaging 1.00
R1922:Dclre1c UTSW 2 3440782 missense possibly damaging 0.95
R1994:Dclre1c UTSW 2 3437985 missense probably damaging 1.00
R4420:Dclre1c UTSW 2 3433745 critical splice acceptor site probably null
R4710:Dclre1c UTSW 2 3440861 critical splice donor site probably null
R5789:Dclre1c UTSW 2 3437956 missense probably damaging 1.00
R6113:Dclre1c UTSW 2 3452863 missense probably damaging 1.00
R6148:Dclre1c UTSW 2 3437705 missense probably damaging 1.00
R6519:Dclre1c UTSW 2 3429329 missense probably damaging 1.00
R6964:Dclre1c UTSW 2 3453169 missense possibly damaging 0.68
Z1088:Dclre1c UTSW 2 3438080 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCTGTTCTGTGCATGCATG -3'
(R):5'- AGACTTCCCACTGTGGTATGTC -3'

Sequencing Primer
(F):5'- ATGCATGCCTGTTTCATTTGTTC -3'
(R):5'- TGGTATGTCCACATCCGGATCAG -3'
Posted On2015-07-07