Incidental Mutation 'R4418:Rxfp2'
ID326929
Institutional Source Beutler Lab
Gene Symbol Rxfp2
Ensembl Gene ENSMUSG00000053368
Gene Namerelaxin/insulin-like family peptide receptor 2
SynonymsGpr106, Great, LGR8
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150018675-150082184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150048800 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 158 (H158L)
Ref Sequence ENSEMBL: ENSMUSP00000144536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]
Predicted Effect probably benign
Transcript: ENSMUST00000065745
AA Change: H158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368
AA Change: H158L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 8.98e1 SMART
LRR_TYP 287 310 2.24e-3 SMART
LRR 311 334 1.15e1 SMART
LRR 335 358 2.14e1 SMART
Pfam:7tm_1 415 674 1.4e-26 PFAM
low complexity region 682 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110496
AA Change: H158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368
AA Change: H158L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 2.82e0 SMART
LRR 287 310 1.15e1 SMART
LRR 311 334 2.14e1 SMART
Pfam:7tm_1 391 650 1.5e-27 PFAM
low complexity region 658 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143989
Predicted Effect probably benign
Transcript: ENSMUST00000201612
AA Change: H158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368
AA Change: H158L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 1.3e-13 SMART
LRRNT 93 124 1.9e-2 SMART
LRR 120 142 7.4e-1 SMART
LRR 143 166 2.9e-2 SMART
LRR_TYP 167 190 1.2e-7 SMART
LRR 229 252 5.4e-2 SMART
LRR 253 276 1.1e-1 SMART
LRR 277 300 1.2e-2 SMART
LRR 301 324 5e-2 SMART
LRR 325 348 9.3e-2 SMART
Pfam:7tm_1 405 664 1.5e-24 PFAM
low complexity region 672 685 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Rxfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rxfp2 APN 5 150066428 missense probably benign
IGL00984:Rxfp2 APN 5 150067132 missense probably benign 0.24
IGL02475:Rxfp2 APN 5 150063686 missense probably benign 0.07
IGL02637:Rxfp2 APN 5 150055913 missense probably damaging 0.99
IGL02992:Rxfp2 APN 5 150051556 missense probably benign 0.01
IGL03052:Rxfp2 APN 5 150043180 splice site probably benign
IGL03203:Rxfp2 APN 5 150063680 missense probably benign 0.08
R0158:Rxfp2 UTSW 5 150051628 missense probably benign 0.14
R0394:Rxfp2 UTSW 5 150067388 missense probably benign 0.03
R0499:Rxfp2 UTSW 5 150066415 missense probably damaging 1.00
R0576:Rxfp2 UTSW 5 150038247 missense probably benign 0.01
R0720:Rxfp2 UTSW 5 150044119 missense probably benign 0.04
R1172:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1173:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1174:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1175:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1606:Rxfp2 UTSW 5 150059897 missense probably benign
R1720:Rxfp2 UTSW 5 150043099 nonsense probably null
R2040:Rxfp2 UTSW 5 150070212 missense probably benign
R3029:Rxfp2 UTSW 5 150043130 missense probably benign 0.05
R3905:Rxfp2 UTSW 5 150055985 splice site probably null
R4056:Rxfp2 UTSW 5 150051633 critical splice donor site probably null
R4156:Rxfp2 UTSW 5 150051555 missense probably benign 0.01
R4282:Rxfp2 UTSW 5 150070270 missense possibly damaging 0.94
R4935:Rxfp2 UTSW 5 150051632 critical splice donor site probably null
R5010:Rxfp2 UTSW 5 150067360 missense probably damaging 1.00
R5286:Rxfp2 UTSW 5 150035444 missense probably damaging 1.00
R5373:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5374:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5530:Rxfp2 UTSW 5 150056810 missense probably damaging 1.00
R5844:Rxfp2 UTSW 5 150043124 missense probably benign 0.00
R6021:Rxfp2 UTSW 5 150063737 missense possibly damaging 0.46
R6211:Rxfp2 UTSW 5 150044126 splice site probably null
R6401:Rxfp2 UTSW 5 150043130 missense probably benign
R6841:Rxfp2 UTSW 5 150018745 start gained probably benign
R6981:Rxfp2 UTSW 5 150048848 splice site probably null
R7012:Rxfp2 UTSW 5 150081194 missense probably benign 0.00
R7032:Rxfp2 UTSW 5 150070348 missense probably damaging 1.00
R7151:Rxfp2 UTSW 5 150043107 missense probably benign 0.01
R7205:Rxfp2 UTSW 5 150059899 missense probably benign 0.05
R7205:Rxfp2 UTSW 5 150059903 missense probably benign 0.00
X0067:Rxfp2 UTSW 5 150051618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATGGCCAGTCTTCATCGC -3'
(R):5'- TGCTGTGGAAGTAGTCTAACAAC -3'

Sequencing Primer
(F):5'- GCCAGTCTTCATCGCATGCC -3'
(R):5'- CTCACATTAGGCAAGTGCTCTGAG -3'
Posted On2015-07-07