Incidental Mutation 'R4418:Opn1sw'
ID326930
Institutional Source Beutler Lab
Gene Symbol Opn1sw
Ensembl Gene ENSMUSG00000058831
Gene Nameopsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
SynonymsBlue/UV Opsin, Bcp, UV cone pigment, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.041) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29376671-29388468 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 29379424 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 45 (R45*)
Ref Sequence ENSEMBL: ENSMUSP00000133534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031779] [ENSMUST00000080428] [ENSMUST00000090481] [ENSMUST00000147483] [ENSMUST00000172974] [ENSMUST00000173216] [ENSMUST00000173653] [ENSMUST00000173694] [ENSMUST00000174096]
Predicted Effect probably benign
Transcript: ENSMUST00000031779
SMART Domains Protein: ENSMUSP00000031779
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 3e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080428
AA Change: R194*
SMART Domains Protein: ENSMUSP00000079289
Gene: ENSMUSG00000058831
AA Change: R194*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 41 318 4e-9 PFAM
Pfam:7tm_1 49 301 2.5e-43 PFAM
Pfam:7tm_4 188 319 6.2e-8 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090481
SMART Domains Protein: ENSMUSP00000087967
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.82e0 SMART
EFh 108 136 2.44e1 SMART
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138523
Predicted Effect probably null
Transcript: ENSMUST00000147483
AA Change: R194*
SMART Domains Protein: ENSMUSP00000133745
Gene: ENSMUSG00000058831
AA Change: R194*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 250 9.2e-7 PFAM
Pfam:7TM_GPCR_Srv 41 254 1.8e-6 PFAM
Pfam:7tm_1 49 271 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172607
SMART Domains Protein: ENSMUSP00000133609
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
Blast:EFh 2 20 1e-5 BLAST
SCOP:d2mysb_ 2 51 6e-5 SMART
Blast:EFh 28 56 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172974
SMART Domains Protein: ENSMUSP00000133390
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 1e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 1.41e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173216
SMART Domains Protein: ENSMUSP00000134708
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
EFh 3 31 9.61e1 SMART
EFh 40 68 2.03e-2 SMART
Blast:EFh 81 109 2e-11 BLAST
EFh 117 145 5.75e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173653
AA Change: R45*
SMART Domains Protein: ENSMUSP00000133534
Gene: ENSMUSG00000058831
AA Change: R45*

DomainStartEndE-ValueType
Pfam:7tm_1 1 61 6.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173694
SMART Domains Protein: ENSMUSP00000133436
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 5.38e0 SMART
EFh 108 136 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174096
SMART Domains Protein: ENSMUSP00000133945
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EF-hand_7 43 97 5.3e-8 PFAM
Pfam:EF-hand_6 72 101 6.5e-5 PFAM
Pfam:EF-hand_7 72 133 5e-12 PFAM
Pfam:EF-hand_5 73 98 4.5e-5 PFAM
Meta Mutation Damage Score 0.6252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family, opsin subfamily. It encodes the blue cone pigment gene which is one of three types of cone photoreceptors responsible for normal color vision. Defects in this gene are the cause of tritan color blindness (tritanopia). Affected individuals lack blue and yellow sensory mechanisms while retaining those for red and green. Defective blue vision is characteristic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal cone physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Opn1sw
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Opn1sw APN 6 29379804 missense possibly damaging 0.88
R0550:Opn1sw UTSW 6 29380204 missense probably damaging 1.00
R1533:Opn1sw UTSW 6 29378924 missense probably benign 0.36
R1902:Opn1sw UTSW 6 29379804 missense possibly damaging 0.88
R4085:Opn1sw UTSW 6 29380144 missense possibly damaging 0.89
R4812:Opn1sw UTSW 6 29378039 missense probably damaging 0.99
R5692:Opn1sw UTSW 6 29379841 unclassified probably benign
R5839:Opn1sw UTSW 6 29379830 missense probably damaging 1.00
R5915:Opn1sw UTSW 6 29379755 unclassified probably null
R6045:Opn1sw UTSW 6 29379870 missense probably damaging 1.00
R6295:Opn1sw UTSW 6 29379414 missense possibly damaging 0.90
R6784:Opn1sw UTSW 6 29379847 missense probably damaging 1.00
R7259:Opn1sw UTSW 6 29378912 missense probably benign
R7315:Opn1sw UTSW 6 29379363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACCACGGATATTCTAGACGTATC -3'
(R):5'- CGCTGGAGACATCAATGGTTAC -3'

Sequencing Primer
(F):5'- CACGGATATTCTAGACGTATCCTGAG -3'
(R):5'- GGAGACATCAATGGTTACTCTGCC -3'
Posted On2015-07-07