Incidental Mutation 'R4418:Osbpl5'
ID326935
Institutional Source Beutler Lab
Gene Symbol Osbpl5
Ensembl Gene ENSMUSG00000037606
Gene Nameoxysterol binding protein-like 5
SynonymsObph1, ORP5, 1110006M06Rik
MMRRC Submission 041139-MU
Accession Numbers

Genbank: NM_024289 ; MGI: 1930265

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143688762-143756985 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 143709815 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 98 (C98*)
Ref Sequence ENSEMBL: ENSMUSP00000115141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020411] [ENSMUST00000119499] [ENSMUST00000134056]
Predicted Effect probably null
Transcript: ENSMUST00000020411
AA Change: C110*
SMART Domains Protein: ENSMUSP00000020411
Gene: ENSMUSG00000037606
AA Change: C110*

DomainStartEndE-ValueType
PH 151 269 1.02e-14 SMART
Pfam:Oxysterol_BP 394 738 2.9e-91 PFAM
transmembrane domain 879 897 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119499
AA Change: C86*
SMART Domains Protein: ENSMUSP00000113362
Gene: ENSMUSG00000037606
AA Change: C86*

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121409
AA Change: C86*
SMART Domains Protein: ENSMUSP00000113375
Gene: ENSMUSG00000037606
AA Change: C86*

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134056
AA Change: C98*
SMART Domains Protein: ENSMUSP00000115141
Gene: ENSMUSG00000037606
AA Change: C98*

DomainStartEndE-ValueType
PDB:1V88|A 122 187 7e-33 PDB
SCOP:d1fgya_ 125 187 3e-10 SMART
Blast:PH 127 187 5e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153864
Meta Mutation Damage Score 0.652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors that play a key role in the maintenance of cholesterol balance in the body. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. This gene has been shown to be imprinted, with preferential expression from the maternal allele only in placenta. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Osbpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Osbpl5 APN 7 143715693 nonsense probably null
IGL01996:Osbpl5 APN 7 143707344 critical splice donor site probably null
IGL02135:Osbpl5 APN 7 143705125 missense probably damaging 1.00
IGL02331:Osbpl5 APN 7 143709795 missense probably benign 0.22
IGL02993:Osbpl5 APN 7 143699334 critical splice acceptor site probably null
R0240:Osbpl5 UTSW 7 143741669 splice site probably null
R0601:Osbpl5 UTSW 7 143709549 missense probably damaging 0.98
R0609:Osbpl5 UTSW 7 143694821 missense probably damaging 0.99
R0659:Osbpl5 UTSW 7 143705030 missense probably damaging 0.97
R1532:Osbpl5 UTSW 7 143695080 missense probably benign
R1579:Osbpl5 UTSW 7 143709202 missense possibly damaging 0.93
R1595:Osbpl5 UTSW 7 143703218 missense possibly damaging 0.88
R1666:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1668:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1713:Osbpl5 UTSW 7 143694373 missense probably damaging 1.00
R1868:Osbpl5 UTSW 7 143715773 missense probably damaging 1.00
R1901:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1902:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1903:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1911:Osbpl5 UTSW 7 143689925 missense probably benign 0.00
R1982:Osbpl5 UTSW 7 143741671 critical splice donor site probably null
R2014:Osbpl5 UTSW 7 143741692 missense probably damaging 0.98
R2076:Osbpl5 UTSW 7 143709144 missense probably damaging 1.00
R2192:Osbpl5 UTSW 7 143693859 nonsense probably null
R2256:Osbpl5 UTSW 7 143709094 missense probably damaging 1.00
R4271:Osbpl5 UTSW 7 143695602 nonsense probably null
R4450:Osbpl5 UTSW 7 143694906 missense probably benign 0.00
R4573:Osbpl5 UTSW 7 143694316 missense probably benign 0.00
R5325:Osbpl5 UTSW 7 143691928 missense probably damaging 0.99
R5439:Osbpl5 UTSW 7 143741696 missense possibly damaging 0.83
R5617:Osbpl5 UTSW 7 143692947 missense possibly damaging 0.89
R5775:Osbpl5 UTSW 7 143704529 missense probably benign 0.00
R5935:Osbpl5 UTSW 7 143756958 start gained probably benign
R6906:Osbpl5 UTSW 7 143694328 missense probably damaging 0.99
R7076:Osbpl5 UTSW 7 143709840 missense probably benign 0.12
R7117:Osbpl5 UTSW 7 143709783 missense probably benign 0.01
R7292:Osbpl5 UTSW 7 143701278 missense probably damaging 1.00
YA93:Osbpl5 UTSW 7 143693870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGAGAATATGTGGGTCATGG -3'
(R):5'- ACTACCATGTCCTAGCTGCC -3'

Sequencing Primer
(F):5'- GGTCATGGAGTGCATGGAC -3'
(R):5'- TCATAGTTCAGGGGCACAGTC -3'
Posted On2015-07-07