Incidental Mutation 'R4418:Wasf1'
ID326945
Institutional Source Beutler Lab
Gene Symbol Wasf1
Ensembl Gene ENSMUSG00000019831
Gene NameWAS protein family, member 1
SynonymsWAVE-1, Scar, WAVE
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location40883475-40938570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40936582 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 456 (H456Y)
Ref Sequence ENSEMBL: ENSMUSP00000101148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019975] [ENSMUST00000105509]
Predicted Effect unknown
Transcript: ENSMUST00000019975
AA Change: H456Y
SMART Domains Protein: ENSMUSP00000019975
Gene: ENSMUSG00000019831
AA Change: H456Y

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105509
AA Change: H456Y
SMART Domains Protein: ENSMUSP00000101148
Gene: ENSMUSG00000019831
AA Change: H456Y

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene has been associated with both morphological and functional defects of the central nervous system. Targeted mutagenesis has resulted in mice that display sensorimotor and cognitive defects similar to those exhibited by patients with 3p-syndrome mental retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Wasf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Wasf1 APN 10 40920297 missense probably damaging 1.00
IGL01978:Wasf1 APN 10 40936201 missense unknown
IGL02265:Wasf1 APN 10 40936441 missense unknown
IGL02565:Wasf1 APN 10 40936132 missense possibly damaging 0.70
IGL02741:Wasf1 APN 10 40930709 missense probably damaging 1.00
IGL03037:Wasf1 APN 10 40930658 missense probably benign 0.42
potatoes UTSW 10 40926620 critical splice donor site probably null
K3955:Wasf1 UTSW 10 40936195 missense unknown
R0652:Wasf1 UTSW 10 40931906 splice site probably null
R1276:Wasf1 UTSW 10 40936526 missense unknown
R1774:Wasf1 UTSW 10 40934479 missense possibly damaging 0.50
R1813:Wasf1 UTSW 10 40926589 missense probably damaging 1.00
R3607:Wasf1 UTSW 10 40936384 missense unknown
R4952:Wasf1 UTSW 10 40936190 missense unknown
R4997:Wasf1 UTSW 10 40934604 missense probably damaging 0.96
R5178:Wasf1 UTSW 10 40937676 missense unknown
R5718:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5789:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5791:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5839:Wasf1 UTSW 10 40936319 missense unknown
R6247:Wasf1 UTSW 10 40937745 missense unknown
R6688:Wasf1 UTSW 10 40926620 critical splice donor site probably null
R6889:Wasf1 UTSW 10 40920369 missense probably damaging 1.00
R6977:Wasf1 UTSW 10 40926585 missense probably damaging 0.97
R7023:Wasf1 UTSW 10 40936475 missense unknown
R7136:Wasf1 UTSW 10 40926591 missense possibly damaging 0.91
R7224:Wasf1 UTSW 10 40926550 missense probably benign 0.17
X0025:Wasf1 UTSW 10 40936697 missense unknown
X0067:Wasf1 UTSW 10 40937657 missense unknown
Predicted Primers PCR Primer
(F):5'- AATTGCTCCTCCTCTAGTGCAG -3'
(R):5'- AGCTAAGAACTGGGGAGGTTTC -3'

Sequencing Primer
(F):5'- AGCCCTCTCCCCCAGTAG -3'
(R):5'- GAGGTTTCCCGAAGCACAC -3'
Posted On2015-07-07