Incidental Mutation 'R4418:Naip6'
ID326964
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4418 (G1)
Quality Score100
Status Validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100300600 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 472 (A472T)
Ref Sequence ENSEMBL: ENSMUSP00000112867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably benign
Transcript: ENSMUST00000042220
AA Change: A472T

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: A472T

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118574
AA Change: A472T

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: A472T

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTGGTGTTGTAACTGCTG -3'
(R):5'- AACCAGTTTCTGCCACATGAAC -3'

Sequencing Primer
(F):5'- ATGCTGCTGCTCAGACAC -3'
(R):5'- AACTTGCCAGAAGTGTGCTC -3'
Posted On2015-07-07