Incidental Mutation 'R4418:0610009O20Rik'
List |< first << previous [record 22 of 386652] next >> last >|
ID326976
Institutional Source Beutler Lab
Gene Symbol 0610009O20Rik
Ensembl Gene ENSMUSG00000024442
Gene NameRIKEN cDNA 0610009O20 gene
Synonyms
MMRRC Submission 041139-MU
Accession Numbers
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38250249-38262629 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 38261287 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025314]
Predicted Effect probably null
Transcript: ENSMUST00000025314
SMART Domains Protein: ENSMUSP00000025314
Gene: ENSMUSG00000024442

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
low complexity region 127 140 N/A INTRINSIC
SEL1 244 277 1.53e2 SMART
SEL1 278 313 2.8e-9 SMART
SEL1 314 351 3.3e1 SMART
SEL1 352 385 1.31e0 SMART
SEL1 386 421 1.67e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A G 7: 131,222,708 silent Het
5430419D17Rik A T 7: 131,247,465 D783V probably benign Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1133W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 T943A unknown Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E318G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I83N probably benign Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 noncoding transcript Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F963S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R194* probably null Het
Osbpl5 A T 7: 143,709,815 C110* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F256L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Psma3 G A 12: 70,978,753 silent Het
Qser1 A T 2: 104,789,421 S259T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpgrip1 A G 14: 52,136,754 silent Het
Rpl21-ps4 A G 14: 11,227,879 K110E probably benign Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1827Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 L167Q probably damaging Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 C7095S unknown Het
Ugt3a1 T A 15: 9,279,980 silent Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L591F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in 0610009O20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:0610009O20Rik APN 18 38252860 missense probably damaging 0.96
IGL02456:0610009O20Rik APN 18 38261124 missense probably damaging 1.00
JAX1:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0134:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0225:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0511:0610009O20Rik UTSW 18 38254071 critical splice donor site probably null
R0560:0610009O20Rik UTSW 18 38254498 missense probably damaging 1.00
R1899:0610009O20Rik UTSW 18 38258342 missense probably benign 0.04
R3005:0610009O20Rik UTSW 18 38259959 missense possibly damaging 0.92
R3552:0610009O20Rik UTSW 18 38258365 splice site unknown
Predicted Primers PCR Primer
(F):5'- AGGACTGAAGTCTTTCTCCAGC -3'
(R):5'- GGCTTATGTGGAAAGAGGCC -3'

Sequencing Primer
(F):5'- AGCCCCTCCCTCTGCAG -3'
(R):5'- CTTATGTGGAAAGAGGCCCAAGG -3'
Posted OnJul 07, 2015