Incidental Mutation 'R4420:Zc3h15'
ID327032
Institutional Source Beutler Lab
Gene Symbol Zc3h15
Ensembl Gene ENSMUSG00000027091
Gene Namezinc finger CCCH-type containing 15
Synonyms2610312B22Rik, FM22, Ierepo4, 1700006A17Rik, 1810012H02Rik
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location83644435-83664622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83658012 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 98 (A98E)
Ref Sequence ENSEMBL: ENSMUSP00000080301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081591]
Predicted Effect probably damaging
Transcript: ENSMUST00000081591
AA Change: A98E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080301
Gene: ENSMUSG00000027091
AA Change: A98E

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
coiled coil region 60 86 N/A INTRINSIC
ZnF_C3H1 99 125 7.84e-8 SMART
ZnF_C3H1 175 211 3.81e0 SMART
Pfam:DFRP_C 229 336 4.2e-23 PFAM
low complexity region 410 426 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145099
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Zc3h15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Zc3h15 APN 2 83660173 missense probably damaging 1.00
IGL01688:Zc3h15 APN 2 83662192 missense probably damaging 0.99
IGL01951:Zc3h15 APN 2 83661485 missense probably damaging 1.00
IGL02514:Zc3h15 APN 2 83653381 missense probably damaging 1.00
IGL02852:Zc3h15 APN 2 83644671 missense possibly damaging 0.85
IGL03075:Zc3h15 APN 2 83662191 missense possibly damaging 0.95
IGL03055:Zc3h15 UTSW 2 83661171 missense possibly damaging 0.90
R0117:Zc3h15 UTSW 2 83658083 missense possibly damaging 0.51
R0465:Zc3h15 UTSW 2 83663815 splice site probably benign
R1711:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R1861:Zc3h15 UTSW 2 83663990 missense unknown
R2258:Zc3h15 UTSW 2 83657016 missense probably benign 0.00
R2325:Zc3h15 UTSW 2 83653439 missense probably damaging 1.00
R4152:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4154:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R5384:Zc3h15 UTSW 2 83660230 missense possibly damaging 0.55
R6341:Zc3h15 UTSW 2 83661223 missense probably benign 0.11
R6544:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R6923:Zc3h15 UTSW 2 83657056 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAGCTGTAAAGAACTCTCTAGCC -3'
(R):5'- CTGAATCACTGTATTCTAAGCACC -3'

Sequencing Primer
(F):5'- TGTAAAGAACTCTCTAGCCAAATACC -3'
(R):5'- CACATTTTCTCTCCAAAGTG -3'
Posted On2015-07-07