Incidental Mutation 'R4420:Casz1'
ID327037
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 148948918 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1382 (N1382K)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222]
Predicted Effect probably benign
Transcript: ENSMUST00000094464
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122222
AA Change: N1382K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: N1382K

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123548
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCCCATGTTACCCATAATG -3'
(R):5'- TCTGGGGAAACTGAAGTGATC -3'

Sequencing Primer
(F):5'- TGTTACCCATAATGCCCAAGG -3'
(R):5'- CTGAAGTGATCTGGGGGAGG -3'
Posted On2015-07-07