Incidental Mutation 'R4420:Il12rb2'
ID327045
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 67316410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485] [ENSMUST00000117441]
Predicted Effect probably null
Transcript: ENSMUST00000018485
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117441
SMART Domains Protein: ENSMUSP00000113267
Gene: ENSMUSG00000018341

DomainStartEndE-ValueType
Blast:FN3 6 100 1e-41 BLAST
FN3 102 191 3.17e-4 SMART
FN3 200 288 6.45e-5 SMART
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67361905 missense probably benign 0.00
R0462:Il12rb2 UTSW 6 67303610 missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1559:Il12rb2 UTSW 6 67356592 missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67354805 missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67292213 missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67303466 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TTGAGTTGGCTGCAGACACTG -3'
(R):5'- GCCAGCCCTCTACATTCAGATC -3'

Sequencing Primer
(F):5'- TGCAGACACTGATGCCGTC -3'
(R):5'- TCTACATTCAGATCCCACGC -3'
Posted On2015-07-07