Incidental Mutation 'R4420:Il12rb2'
ID 327045
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Name interleukin 12 receptor, beta 2
Synonyms A930027I18Rik, Ifnm, IL-12RB2
MMRRC Submission 041141-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4420 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 67268302-67353172 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 67293394 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485] [ENSMUST00000117441]
AlphaFold P97378
Predicted Effect probably null
Transcript: ENSMUST00000018485
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117441
SMART Domains Protein: ENSMUSP00000113267
Gene: ENSMUSG00000018341

DomainStartEndE-ValueType
Blast:FN3 6 100 1e-41 BLAST
FN3 102 191 3.17e-4 SMART
FN3 200 288 6.45e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,531,515 (GRCm39) probably benign Het
Atp1b1 T C 1: 164,281,127 (GRCm39) T53A probably damaging Het
Carmil3 A G 14: 55,731,045 (GRCm39) Q104R probably damaging Het
Casz1 T G 4: 149,033,375 (GRCm39) N1382K possibly damaging Het
Chfr T A 5: 110,318,746 (GRCm39) C585* probably null Het
Chp2 T C 7: 121,821,161 (GRCm39) F174S probably damaging Het
Dclre1c A T 2: 3,434,782 (GRCm39) probably null Het
Dnah6 A G 6: 73,168,462 (GRCm39) V487A probably benign Het
Dnah9 T C 11: 66,009,575 (GRCm39) R771G probably benign Het
Duox1 G A 2: 122,157,607 (GRCm39) A578T probably benign Het
Elp3 G A 14: 65,818,240 (GRCm39) A140V probably damaging Het
Fbrsl1 T C 5: 110,526,852 (GRCm39) H387R possibly damaging Het
Gnat3 T C 5: 18,204,799 (GRCm39) S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 (GRCm39) L228H probably damaging Het
Gzmn A T 14: 56,403,463 (GRCm39) H215Q probably benign Het
Heg1 A T 16: 33,547,805 (GRCm39) E864V probably benign Het
Hoxb9 T C 11: 96,162,807 (GRCm39) V147A probably benign Het
Hsf5 T G 11: 87,548,130 (GRCm39) H604Q probably benign Het
Hus1 T C 11: 8,950,133 (GRCm39) E196G probably damaging Het
Irs1 T C 1: 82,266,171 (GRCm39) S682G possibly damaging Het
Jcad T C 18: 4,676,032 (GRCm39) S1265P probably benign Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Matk A G 10: 81,098,291 (GRCm39) S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,654,923 (GRCm39) probably benign Het
Nceh1 A G 3: 27,295,798 (GRCm39) D353G probably damaging Het
Nqo1 C T 8: 108,118,749 (GRCm39) probably null Het
Or5t7 A G 2: 86,507,263 (GRCm39) V138A possibly damaging Het
Pcdh7 T C 5: 58,286,512 (GRCm39) I1196T probably benign Het
Pla2g4d A G 2: 120,114,644 (GRCm39) V29A probably benign Het
Ppfibp1 T A 6: 146,927,736 (GRCm39) Y794* probably null Het
Prdx5 C A 19: 6,885,332 (GRCm39) probably null Het
Psme4 C T 11: 30,762,028 (GRCm39) T456I possibly damaging Het
Ptprd A T 4: 75,957,614 (GRCm39) S923R possibly damaging Het
Samd12 G A 15: 53,723,655 (GRCm39) R13W probably damaging Het
Slc35f4 A T 14: 49,551,034 (GRCm39) probably benign Het
Smc1b A G 15: 84,997,031 (GRCm39) Y530H probably damaging Het
Spata2l T C 8: 123,960,768 (GRCm39) T174A possibly damaging Het
Sugct C T 13: 17,627,130 (GRCm39) C241Y probably damaging Het
Tarbp1 G T 8: 127,173,819 (GRCm39) A965D possibly damaging Het
Tas1r3 A G 4: 155,946,789 (GRCm39) V272A probably damaging Het
Tas2r117 T A 6: 132,780,312 (GRCm39) L150* probably null Het
Trip10 C T 17: 57,562,448 (GRCm39) P322L probably benign Het
Wdfy3 A C 5: 102,058,850 (GRCm39) H1487Q probably damaging Het
Wdr95 G A 5: 149,456,131 (GRCm39) V8M probably damaging Het
Zc3h15 C A 2: 83,488,356 (GRCm39) A98E probably damaging Het
Zfp763 T G 17: 33,237,455 (GRCm39) K563N probably benign Het
Zmym2 G A 14: 57,194,335 (GRCm39) D1198N probably damaging Het
Zp1 C T 19: 10,892,124 (GRCm39) probably null Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67,334,676 (GRCm39) missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67,280,546 (GRCm39) missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67,337,551 (GRCm39) missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67,313,738 (GRCm39) missense probably benign
IGL00965:Il12rb2 APN 6 67,337,561 (GRCm39) missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67,338,849 (GRCm39) splice site probably benign
IGL01980:Il12rb2 APN 6 67,337,519 (GRCm39) missense probably benign
IGL02246:Il12rb2 APN 6 67,285,940 (GRCm39) critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67,328,300 (GRCm39) missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67,293,270 (GRCm39) missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67,275,903 (GRCm39) missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67,275,903 (GRCm39) missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67,338,889 (GRCm39) missense probably benign 0.00
R0462:Il12rb2 UTSW 6 67,280,594 (GRCm39) missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67,275,888 (GRCm39) splice site probably benign
R0828:Il12rb2 UTSW 6 67,333,691 (GRCm39) missense probably benign
R1051:Il12rb2 UTSW 6 67,333,719 (GRCm39) missense probably benign
R1191:Il12rb2 UTSW 6 67,275,200 (GRCm39) missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67,286,127 (GRCm39) missense probably benign
R1559:Il12rb2 UTSW 6 67,333,576 (GRCm39) missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67,280,485 (GRCm39) missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67,313,744 (GRCm39) missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67,272,270 (GRCm39) nonsense probably null
R1952:Il12rb2 UTSW 6 67,269,300 (GRCm39) missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67,337,529 (GRCm39) missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67,337,536 (GRCm39) missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67,338,928 (GRCm39) nonsense probably null
R2358:Il12rb2 UTSW 6 67,275,179 (GRCm39) missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67,331,789 (GRCm39) missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67,337,552 (GRCm39) missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67,337,782 (GRCm39) missense probably damaging 1.00
R4838:Il12rb2 UTSW 6 67,286,121 (GRCm39) missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67,269,404 (GRCm39) missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67,269,246 (GRCm39) missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67,272,262 (GRCm39) missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67,269,197 (GRCm39) missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67,337,674 (GRCm39) missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67,333,670 (GRCm39) missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67,338,950 (GRCm39) start gained probably benign
R6813:Il12rb2 UTSW 6 67,269,358 (GRCm39) missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67,269,636 (GRCm39) missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67,333,617 (GRCm39) missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67,280,450 (GRCm39) missense possibly damaging 0.48
R7813:Il12rb2 UTSW 6 67,333,635 (GRCm39) missense possibly damaging 0.72
R7992:Il12rb2 UTSW 6 67,328,311 (GRCm39) nonsense probably null
R8422:Il12rb2 UTSW 6 67,337,800 (GRCm39) missense probably benign 0.20
R8752:Il12rb2 UTSW 6 67,328,265 (GRCm39) missense probably damaging 1.00
R9648:Il12rb2 UTSW 6 67,333,587 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTGAGTTGGCTGCAGACACTG -3'
(R):5'- GCCAGCCCTCTACATTCAGATC -3'

Sequencing Primer
(F):5'- TGCAGACACTGATGCCGTC -3'
(R):5'- TCTACATTCAGATCCCACGC -3'
Posted On 2015-07-07