Incidental Mutation 'R4420:Mroh5'
ID327071
Institutional Source Beutler Lab
Gene Symbol Mroh5
Ensembl Gene ENSMUSG00000072487
Gene Namemaestro heat-like repeat family member 5
SynonymsLOC268816, Gm628
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4420 (G1)
Quality Score217
Status Validated
Chromosome15
Chromosomal Location73761410-73839699 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGGAG to TG at 73783074 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071419] [ENSMUST00000110021] [ENSMUST00000151999]
Predicted Effect probably benign
Transcript: ENSMUST00000071419
SMART Domains Protein: ENSMUSP00000071366
Gene: ENSMUSG00000072487

DomainStartEndE-ValueType
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126186
Predicted Effect probably benign
Transcript: ENSMUST00000151999
SMART Domains Protein: ENSMUSP00000118236
Gene: ENSMUSG00000072487

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
SCOP:d1gw5a_ 294 635 1e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Mroh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Mroh5 APN 15 73792789 splice site probably benign
IGL00466:Mroh5 APN 15 73792789 splice site probably benign
IGL02937:Mroh5 APN 15 73789978 missense probably damaging 1.00
R0102:Mroh5 UTSW 15 73819350 missense probably benign 0.07
R0321:Mroh5 UTSW 15 73790043 missense probably damaging 1.00
R0433:Mroh5 UTSW 15 73790028 missense probably benign 0.01
R0433:Mroh5 UTSW 15 73790808 missense probably damaging 1.00
R0707:Mroh5 UTSW 15 73790739 missense possibly damaging 0.48
R1666:Mroh5 UTSW 15 73787905 missense probably benign 0.43
R1668:Mroh5 UTSW 15 73787905 missense probably benign 0.43
R2139:Mroh5 UTSW 15 73790091 missense probably damaging 1.00
R2269:Mroh5 UTSW 15 73793148 missense probably benign 0.02
R4078:Mroh5 UTSW 15 73786040 missense possibly damaging 0.79
R4460:Mroh5 UTSW 15 73791796 missense probably damaging 0.97
R4585:Mroh5 UTSW 15 73789271 missense probably benign 0.38
R5285:Mroh5 UTSW 15 73783074 small deletion probably benign
R5287:Mroh5 UTSW 15 73783074 small deletion probably benign
R5437:Mroh5 UTSW 15 73787969 missense probably benign 0.02
R5760:Mroh5 UTSW 15 73821507 missense probably damaging 0.98
R5972:Mroh5 UTSW 15 73790719 critical splice donor site probably null
R6192:Mroh5 UTSW 15 73790781 missense probably damaging 1.00
R6457:Mroh5 UTSW 15 73790842 missense probably damaging 1.00
R6477:Mroh5 UTSW 15 73790755 missense probably damaging 1.00
R6776:Mroh5 UTSW 15 73789968 critical splice donor site probably null
R6979:Mroh5 UTSW 15 73793129 missense probably benign 0.16
X0024:Mroh5 UTSW 15 73787721 missense probably benign 0.01
Z1088:Mroh5 UTSW 15 73788031 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TACAAGGTTCACACTGTCCAG -3'
(R):5'- GCCAGTTACTAATGGTCCCAG -3'

Sequencing Primer
(F):5'- CAGTGTCTGCTGGTGTCCC -3'
(R):5'- TCCCAGCTGGACTCCTG -3'
Posted On2015-07-07