Incidental Mutation 'R4422:Dlgap2'
ID327150
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission 041695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4422 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 14743463 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably null
Transcript: ENSMUST00000043279
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133298
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141214
Predicted Effect probably null
Transcript: ENSMUST00000150247
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152652
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155211
Meta Mutation Damage Score 0.562 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 27,005,400 S1168P probably benign Het
Adgrf2 T C 17: 42,713,155 M142V probably benign Het
Akna G T 4: 63,387,093 Q479K possibly damaging Het
Arhgef9 T G X: 95,101,064 I131L possibly damaging Het
AW551984 A T 9: 39,600,077 C111S probably null Het
Bak1 C A 17: 27,021,324 G130W probably damaging Het
Bank1 T A 3: 136,083,211 Q441L probably damaging Het
C030034I22Rik T C 17: 69,418,158 noncoding transcript Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cct7 A G 6: 85,467,145 R355G probably damaging Het
Cd19 C T 7: 126,413,406 V272I probably benign Het
Cenpf A G 1: 189,658,350 L1095S probably damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Chrm3 A T 13: 9,878,555 Y148* probably null Het
Chrnb3 T C 8: 27,396,733 V445A possibly damaging Het
Col4a4 T A 1: 82,489,838 M852L unknown Het
Dhx29 T C 13: 112,947,247 L612P probably damaging Het
Dnah17 T C 11: 118,081,973 T2045A possibly damaging Het
Dync1li1 A G 9: 114,709,309 T245A probably damaging Het
Epha4 T C 1: 77,511,717 E42G probably damaging Het
Fam120b C A 17: 15,402,183 T141K probably damaging Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gcnt2 T G 13: 40,860,525 Y57* probably null Het
Gm5409 C T 6: 41,419,585 noncoding transcript Het
Hip1r A G 5: 123,997,006 K402E possibly damaging Het
Hlcs G A 16: 94,138,960 P506L possibly damaging Het
Itih4 T A 14: 30,889,864 F142I probably damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lamb2 A G 9: 108,483,555 D518G probably damaging Het
Ldlr G A 9: 21,737,952 C341Y probably damaging Het
Lsr G T 7: 30,965,997 N177K probably benign Het
Macf1 G A 4: 123,466,046 S1815F probably damaging Het
Mms22l T C 4: 24,503,008 S95P probably damaging Het
Mon2 A G 10: 123,042,982 L218P probably damaging Het
Nlrp4f C T 13: 65,184,962 probably null Het
Nrde2 G A 12: 100,146,027 Q137* probably null Het
Olfr1145 C A 2: 87,810,645 T275K probably damaging Het
Olfr5 G T 7: 6,481,038 Y39* probably null Het
Olfr606 G T 7: 103,452,243 R302L probably damaging Het
Phf24 G A 4: 42,934,817 C151Y probably damaging Het
Pik3r1 T G 13: 101,694,384 N3T probably benign Het
Plcb2 T C 2: 118,712,003 K821E probably benign Het
Ppat A G 5: 76,915,214 W517R probably damaging Het
Prelid2 T C 18: 41,912,396 T150A probably benign Het
Psg21 A G 7: 18,647,332 S429P probably damaging Het
Reg4 T C 3: 98,233,044 Y114H possibly damaging Het
Rsbn1l G T 5: 20,896,546 H665Q probably damaging Het
Rspo2 T C 15: 43,169,754 N24S probably benign Het
Ryr2 G T 13: 11,717,066 C2329* probably null Het
Skint2 T A 4: 112,584,588 probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Thegl T C 5: 77,054,536 I268T possibly damaging Het
Tmem53 T C 4: 117,265,952 Y37H probably damaging Het
Tmem59l G A 8: 70,486,099 R111W probably damaging Het
Tnks2 G A 19: 36,845,653 V107I probably damaging Het
Tpcn1 T C 5: 120,542,518 K549R probably damaging Het
Tubgcp4 T A 2: 121,189,401 L404* probably null Het
Vmn2r86 T C 10: 130,452,976 I219V possibly damaging Het
Vsig10 T C 5: 117,324,921 S71P probably benign Het
Wnk1 T C 6: 119,953,895 N896S probably benign Het
Zfp871 C A 17: 32,774,833 S456I probably benign Het
Zfp871 T A 17: 32,774,834 S437C probably benign Het
Zfp873 A G 10: 82,060,874 T480A probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GATATGGGCTGTCTCTGCTC -3'
(R):5'- CAACCAGAGGTCTACTTGGC -3'

Sequencing Primer
(F):5'- AGGTGCCTCAGGACGATTG -3'
(R):5'- AGAGGTCTACTTGGCCATCC -3'
Posted On2015-07-07