Incidental Mutation 'R0016:Nckap1l'
ID32724
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103475636 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 554 (T554A)
Ref Sequence ENSEMBL: ENSMUSP00000035400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect probably benign
Transcript: ENSMUST00000047405
AA Change: T554A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: T554A

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230276
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense probably null
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0137:Nckap1l UTSW 15 103481964 missense probably benign 0.01
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0412:Nckap1l UTSW 15 103464652 missense probably benign 0.01
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1245:Nckap1l UTSW 15 103455925 missense probably damaging 1.00
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4270:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGCAAGTCTGTCATTGCACTTCTC -3'
(R):5'- TGTTCCGCACATATCTCAAGCACAC -3'

Sequencing Primer
(F):5'- CTCTGAAAGCCATTTCAAGACTCTG -3'
(R):5'- TCAAGCACACAGTTGCTGG -3'
Posted On2013-05-09