Incidental Mutation 'R0016:Paxbp1'
ID32728
Institutional Source Beutler Lab
Gene Symbol Paxbp1
Ensembl Gene ENSMUSG00000022974
Gene NamePAX3 and PAX7 binding protein 1
Synonyms
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location91014037-91044543 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 91036036 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118522]
Predicted Effect probably benign
Transcript: ENSMUST00000023698
SMART Domains Protein: ENSMUSP00000023698
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 60 86 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 434 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118522
SMART Domains Protein: ENSMUSP00000113835
Gene: ENSMUSG00000022974

DomainStartEndE-ValueType
coiled coil region 3 28 N/A INTRINSIC
low complexity region 114 120 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
Pfam:GCFC 597 812 5.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127002
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may bind to GC-rich DNA sequences, which suggests its involvement in the regulation of transcription. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Paxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Paxbp1 APN 16 91035916 splice site probably benign
IGL01705:Paxbp1 APN 16 91016988 missense probably benign 0.01
IGL02418:Paxbp1 APN 16 91034112 missense probably damaging 1.00
IGL02527:Paxbp1 APN 16 91037273 missense possibly damaging 0.57
IGL02661:Paxbp1 APN 16 91030525 missense probably benign 0.43
IGL02796:Paxbp1 APN 16 91025294 unclassified probably benign
IGL03336:Paxbp1 APN 16 91034172 missense probably benign
R0306:Paxbp1 UTSW 16 91022115 missense possibly damaging 0.54
R0331:Paxbp1 UTSW 16 91037367 missense possibly damaging 0.95
R0724:Paxbp1 UTSW 16 91036536 missense probably damaging 1.00
R0944:Paxbp1 UTSW 16 91023427 missense probably benign 0.25
R1348:Paxbp1 UTSW 16 91035016 missense probably damaging 0.97
R1909:Paxbp1 UTSW 16 91044305 unclassified probably benign
R2234:Paxbp1 UTSW 16 91034934 missense probably benign 0.05
R3156:Paxbp1 UTSW 16 91035990 missense probably benign 0.00
R3819:Paxbp1 UTSW 16 91022752 unclassified probably benign
R3910:Paxbp1 UTSW 16 91042681 missense probably damaging 1.00
R3949:Paxbp1 UTSW 16 91044017 missense probably damaging 1.00
R4109:Paxbp1 UTSW 16 91016898 missense probably benign 0.10
R4577:Paxbp1 UTSW 16 91015154 missense probably damaging 1.00
R4584:Paxbp1 UTSW 16 91034123 missense probably damaging 1.00
R4596:Paxbp1 UTSW 16 91030547 missense probably benign 0.28
R4837:Paxbp1 UTSW 16 91034978 nonsense probably null
R4877:Paxbp1 UTSW 16 91044311 unclassified probably benign
R5079:Paxbp1 UTSW 16 91025146 critical splice donor site probably null
R5086:Paxbp1 UTSW 16 91015216 unclassified probably benign
R5167:Paxbp1 UTSW 16 91022667 critical splice donor site probably null
R5291:Paxbp1 UTSW 16 91044352 start codon destroyed probably null
R5322:Paxbp1 UTSW 16 91015162 missense probably benign 0.01
R5529:Paxbp1 UTSW 16 91030513 missense possibly damaging 0.62
R5662:Paxbp1 UTSW 16 91037397 missense probably benign 0.45
R5814:Paxbp1 UTSW 16 91030496 missense probably damaging 1.00
R6422:Paxbp1 UTSW 16 91023444 missense probably benign 0.07
X0026:Paxbp1 UTSW 16 91027242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGATGCTGCTGCTGAAGGAC -3'
(R):5'- TGCGCTGCATTAGACAGACGAC -3'

Sequencing Primer
(F):5'- GCAAACTCTGACATAGTGTCTC -3'
(R):5'- AACTGTTCTCGCCAGAGTACG -3'
Posted On2013-05-09