Incidental Mutation 'R4352:Shh'
ID327331
Institutional Source Beutler Lab
Gene Symbol Shh
Ensembl Gene ENSMUSG00000002633
Gene Namesonic hedgehog
SynonymsHx, Hxl3, Hhg1, M100081
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4352 (G1)
Quality Score103
Status Validated
Chromosome5
Chromosomal Location28456815-28467256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28458189 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 327 (E327G)
Ref Sequence ENSEMBL: ENSMUSP00000002708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002708]
PDB Structure
A POTENTIAL CATALYTIC SITE WITHIN THE AMINO-TERMINAL SIGNALLING DOMAIN OF SONIC HEDGEHOG [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN HEDGEHOG-INTERACTING PROTEIN HIP AND SONIC HEDGEHOG IN THE PRESENCE OF CALCIUM [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN HEDGEHOG-INTERACTING PROTEIN HIP AND SONIC HEDGEHOG WITHOUT CALCIUM [X-RAY DIFFRACTION]
Crystal Structure of Sonic Hedgehog Bound to the third FNIII domain of CDO [X-RAY DIFFRACTION]
Crystal Structure of ShhN [X-RAY DIFFRACTION]
Crystal structure of the Sonic Hedgehog-chondroitin-4-sulphate complex [X-RAY DIFFRACTION]
Crystal structure of the Sonic Hedgehog-heparin complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002708
AA Change: E327G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002708
Gene: ENSMUSG00000002633
AA Change: E327G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:HH_signal 25 185 5.6e-92 PFAM
HintN 197 305 1.21e-30 SMART
HintC 310 355 4.58e-8 SMART
low complexity region 359 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180878
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes exhibit shortening of all digits, holes between the frontal bones, dyssymphyses between cervical vertebrae and bony plates over many ribs. Homozygotes usually die before E12, are short-limbed dwarfs and lack forefeet, hindfeet, eyes, ears, external genitalia and a mouth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Shh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Shh APN 5 28461371 missense probably damaging 1.00
R2484:Shh UTSW 5 28466742 missense probably benign 0.22
R4153:Shh UTSW 5 28457949 missense probably damaging 1.00
R4668:Shh UTSW 5 28457855 makesense probably null
R5371:Shh UTSW 5 28466690 missense probably damaging 1.00
R5407:Shh UTSW 5 28466580 nonsense probably null
R6035:Shh UTSW 5 28461399 missense probably damaging 1.00
R6035:Shh UTSW 5 28461399 missense probably damaging 1.00
X0019:Shh UTSW 5 28461540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCTTCCGTTGCAGATTG -3'
(R):5'- TTCTACGTGATCGAGACGC -3'

Sequencing Primer
(F):5'- CAGATTGCGCTGCAGGGATG -3'
(R):5'- CTACGTGATCGAGACGCTGGAG -3'
Posted On2015-07-07