Incidental Mutation 'R4352:Itgb2'
ID327349
Institutional Source Beutler Lab
Gene Symbol Itgb2
Ensembl Gene ENSMUSG00000000290
Gene Nameintegrin beta 2
SynonymsMac-1 beta, Cd18, 2E6
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4352 (G1)
Quality Score117
Status Validated
Chromosome10
Chromosomal Location77530252-77565708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77556167 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 358 (N358I)
Ref Sequence ENSEMBL: ENSMUSP00000000299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000153541] [ENSMUST00000156644]
Predicted Effect probably benign
Transcript: ENSMUST00000000299
AA Change: N358I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: N358I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153541
AA Change: N358I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290
AA Change: N358I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156644
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Itgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
barely UTSW 10 77548536 splice site probably benign
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTCGTTGAACGTCCTG -3'
(R):5'- ACAAGCTGTGGCAAGTGACC -3'

Sequencing Primer
(F):5'- TTGAACGTCCTGTGAGCCAG -3'
(R):5'- GGCAAGTGACCGGTCTATATCTC -3'
Posted On2015-07-07