Incidental Mutation 'R4352:Shmt2'
ID327351
Institutional Source Beutler Lab
Gene Symbol Shmt2
Ensembl Gene ENSMUSG00000025403
Gene Nameserine hydroxymethyltransferase 2 (mitochondrial)
Synonyms2700043D08Rik
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127517123-127522444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127518817 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 333 (A333V)
Ref Sequence ENSEMBL: ENSMUSP00000026470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026470] [ENSMUST00000035735] [ENSMUST00000219239]
Predicted Effect probably damaging
Transcript: ENSMUST00000026470
AA Change: A333V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026470
Gene: ENSMUSG00000025403
AA Change: A333V

DomainStartEndE-ValueType
Pfam:SHMT 49 448 5.4e-211 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035735
SMART Domains Protein: ENSMUSP00000042185
Gene: ENSMUSG00000040280

DomainStartEndE-ValueType
Pfam:B12D 16 84 2.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218492
Predicted Effect probably damaging
Transcript: ENSMUST00000219239
AA Change: A330V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220356
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial form of a pyridoxal phosphate-dependent enzyme that catalyzes the reversible reaction of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. The encoded product is primarily responsible for glycine synthesis. The activity of the encoded protein has been suggested to be the primary source of intracellular glycine. The gene which encodes the cytosolic form of this enzyme is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethlity after E13.5, decreased size, anemia and reduced MEF cellular respiration and proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Shmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02862:Shmt2 APN 10 127518874 missense probably benign 0.00
R0057:Shmt2 UTSW 10 127521048 missense possibly damaging 0.88
R0057:Shmt2 UTSW 10 127521048 missense possibly damaging 0.88
R0504:Shmt2 UTSW 10 127520072 missense probably damaging 1.00
R1493:Shmt2 UTSW 10 127518943 unclassified probably null
R2006:Shmt2 UTSW 10 127519160 missense probably benign 0.22
R2342:Shmt2 UTSW 10 127518811 missense possibly damaging 0.94
R2358:Shmt2 UTSW 10 127518028 missense probably benign 0.00
R4998:Shmt2 UTSW 10 127518270 missense probably damaging 1.00
R5242:Shmt2 UTSW 10 127518920 missense probably benign 0.00
R5568:Shmt2 UTSW 10 127520381 missense probably damaging 1.00
R5654:Shmt2 UTSW 10 127517799 missense probably benign 0.05
R6167:Shmt2 UTSW 10 127517862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTACTGAACAAGGAGGACTCC -3'
(R):5'- GTGGATCCTCTGAGCACCTATG -3'

Sequencing Primer
(F):5'- CATGACCCCGGCTTTGCTG -3'
(R):5'- GCACCTATGCCAGTCATCCG -3'
Posted On2015-07-07