Incidental Mutation 'R4352:Lrch1'
ID327363
Institutional Source Beutler Lab
Gene Symbol Lrch1
Ensembl Gene ENSMUSG00000068015
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms4832412D13Rik, Chdc1
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location74754675-74947876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74818578 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 278 (S278R)
Ref Sequence ENSEMBL: ENSMUSP00000154004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088970] [ENSMUST00000228252]
Predicted Effect probably damaging
Transcript: ENSMUST00000088970
AA Change: S278R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086363
Gene: ENSMUSG00000068015
AA Change: S278R

DomainStartEndE-ValueType
low complexity region 25 44 N/A INTRINSIC
LRR 109 131 1.86e1 SMART
LRR_TYP 132 155 3.39e-3 SMART
LRR 177 199 1.41e1 SMART
LRR 200 223 4.34e-1 SMART
LRR 245 268 1.66e1 SMART
low complexity region 306 322 N/A INTRINSIC
CH 591 698 1.71e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228134
Predicted Effect probably damaging
Transcript: ENSMUST00000228252
AA Change: S278R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a leucine-rich repeat and a calponin homology domain. Polymorphism in this gene may be associated with susceptibililty to knee osteoarthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous knockout leads to increased susceptibility to experimental autoimmune encephalomyelitis as a result of increased migration of T cells into the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Lrch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Lrch1 APN 14 74757063 missense probably benign 0.22
IGL01137:Lrch1 APN 14 74757092 missense probably damaging 0.98
IGL01978:Lrch1 APN 14 74786342 missense probably damaging 1.00
IGL01988:Lrch1 APN 14 74795373 splice site probably benign
IGL02036:Lrch1 APN 14 74795293 splice site probably benign
IGL02650:Lrch1 APN 14 74813698 missense probably damaging 1.00
IGL03006:Lrch1 APN 14 74813620 missense probably damaging 0.99
IGL03106:Lrch1 APN 14 74835762 missense possibly damaging 0.84
IGL03353:Lrch1 APN 14 74858042 missense probably damaging 1.00
FR4304:Lrch1 UTSW 14 74819565 missense possibly damaging 0.81
LCD18:Lrch1 UTSW 14 74905021 intron probably benign
R0129:Lrch1 UTSW 14 74835746 missense probably benign 0.13
R0312:Lrch1 UTSW 14 74947594 missense possibly damaging 0.82
R0441:Lrch1 UTSW 14 74947545 missense possibly damaging 0.95
R0622:Lrch1 UTSW 14 74796051 missense probably benign 0.00
R1418:Lrch1 UTSW 14 74804269 splice site probably benign
R1618:Lrch1 UTSW 14 74813704 missense probably damaging 1.00
R2116:Lrch1 UTSW 14 74785531 missense probably damaging 1.00
R2428:Lrch1 UTSW 14 74807545 splice site probably benign
R3707:Lrch1 UTSW 14 74857997 missense probably damaging 0.99
R5689:Lrch1 UTSW 14 74786324 missense probably damaging 1.00
R5754:Lrch1 UTSW 14 74817118 missense probably damaging 1.00
R6142:Lrch1 UTSW 14 74947500 missense probably damaging 1.00
R6469:Lrch1 UTSW 14 74817085 missense probably damaging 1.00
R6740:Lrch1 UTSW 14 74811623 missense probably benign
R6871:Lrch1 UTSW 14 74811623 missense probably benign
R7051:Lrch1 UTSW 14 74785522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGTGTACGGATGCTGACGTC -3'
(R):5'- TTTCTGCCCAAAGTGGAATGTG -3'

Sequencing Primer
(F):5'- ACGGATGCTGACGTCAGGTTATC -3'
(R):5'- GGAAAGAGTCCTAAGAACTCTTGTG -3'
Posted On2015-07-07