Incidental Mutation 'R4352:Dzip1'
ID327364
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene NameDAZ interacting protein 1
Synonyms2510025K24Rik, 2810422M04Rik
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location118875520-118925460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118883526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 673 (D673G)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208]
Predicted Effect probably benign
Transcript: ENSMUST00000004055
AA Change: D673G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: D673G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047208
AA Change: D673G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: D673G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228861
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Rock1 T A 18: 10,079,237 Q1077L probably damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 118883394 missense probably benign 0.41
IGL01534:Dzip1 APN 14 118877239 missense probably damaging 1.00
IGL01617:Dzip1 APN 14 118881065 missense probably benign 0.16
IGL02537:Dzip1 APN 14 118909576 splice site probably benign
IGL02801:Dzip1 APN 14 118885655 nonsense probably null
IGL03354:Dzip1 APN 14 118912569 splice site probably benign
PIT4151001:Dzip1 UTSW 14 118922788 missense probably damaging 1.00
R0325:Dzip1 UTSW 14 118909557 missense probably damaging 0.99
R0357:Dzip1 UTSW 14 118909538 missense probably damaging 0.99
R0592:Dzip1 UTSW 14 118902139 missense probably damaging 1.00
R0942:Dzip1 UTSW 14 118887197 nonsense probably null
R1110:Dzip1 UTSW 14 118889305 missense probably benign 0.15
R1458:Dzip1 UTSW 14 118922713 missense probably benign 0.16
R1541:Dzip1 UTSW 14 118879478 missense probably damaging 1.00
R2046:Dzip1 UTSW 14 118922478 missense probably damaging 1.00
R2178:Dzip1 UTSW 14 118889404 splice site probably null
R2316:Dzip1 UTSW 14 118901540 missense probably benign 0.01
R2504:Dzip1 UTSW 14 118881044 missense probably benign 0.11
R2851:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 118911368 missense probably benign 0.38
R4111:Dzip1 UTSW 14 118877233 nonsense probably null
R4349:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4350:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4351:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4868:Dzip1 UTSW 14 118877214 missense probably damaging 1.00
R5172:Dzip1 UTSW 14 118887151 missense probably damaging 0.97
R5191:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5192:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5376:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5378:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5655:Dzip1 UTSW 14 118887232 critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 118909480 missense probably benign 0.00
R7256:Dzip1 UTSW 14 118885646 missense probably benign 0.00
X0009:Dzip1 UTSW 14 118877214 missense probably damaging 0.98
X0026:Dzip1 UTSW 14 118922457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCACCTGTCAGCTTAGGAG -3'
(R):5'- GATGCGTGCTACTGAAAGC -3'

Sequencing Primer
(F):5'- GAGAGAAGTCCGAGTCATCCATTTC -3'
(R):5'- CCTAGGACTGCGAGCTGAG -3'
Posted On2015-07-07