Incidental Mutation 'R4352:Rock1'
ID327379
Institutional Source Beutler Lab
Gene Symbol Rock1
Ensembl Gene ENSMUSG00000024290
Gene NameRho-associated coiled-coil containing protein kinase 1
Synonyms1110055K06Rik, Rock-I
MMRRC Submission 041668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4352 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10064401-10181792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10079237 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1077 (Q1077L)
Ref Sequence ENSEMBL: ENSMUSP00000069549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067947]
Predicted Effect probably damaging
Transcript: ENSMUST00000067947
AA Change: Q1077L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: Q1077L

DomainStartEndE-ValueType
S_TKc 76 338 4.07e-97 SMART
S_TK_X 341 401 4.02e-9 SMART
low complexity region 408 419 N/A INTRINSIC
PDB:3O0Z|D 535 700 1e-101 PDB
low complexity region 715 731 N/A INTRINSIC
PDB:4L2W|B 832 914 7e-28 PDB
Pfam:Rho_Binding 948 1014 4.3e-26 PFAM
PH 1119 1319 1.19e-6 SMART
C1 1229 1283 2.64e-10 SMART
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ankrd54 A T 15: 79,055,462 F176I probably benign Het
Ano3 T A 2: 110,745,894 E94V possibly damaging Het
Arid1b A T 17: 5,097,584 Q587L possibly damaging Het
Atg2a G A 19: 6,257,457 V1474M probably benign Het
Bcl2a1d A G 9: 88,731,499 V74A probably damaging Het
Bmper A G 9: 23,483,952 I660V probably benign Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cds2 T A 2: 132,263,445 M1K probably null Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Ddx47 C T 6: 135,018,055 T161I probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Emilin2 T C 17: 71,280,731 M129V probably benign Het
Eml1 A T 12: 108,534,837 probably benign Het
Espnl A T 1: 91,334,721 D296V probably damaging Het
Fam161a T G 11: 23,020,798 S109R possibly damaging Het
Fat3 T G 9: 16,246,778 T1179P possibly damaging Het
Gfra1 A T 19: 58,267,024 N330K probably benign Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Gm11639 T A 11: 104,739,314 L957Q probably null Het
Gm12569 A G 11: 51,234,819 N190D possibly damaging Het
Gm20775 A T Y: 10,641,648 noncoding transcript Het
Gm5885 T A 6: 133,531,189 noncoding transcript Het
Gpatch11 T C 17: 78,841,017 L128P probably damaging Het
H2-Q1 A G 17: 35,320,943 N63D possibly damaging Het
Itgb2 A T 10: 77,556,167 N358I probably benign Het
Jmjd1c A G 10: 67,244,809 T2247A probably damaging Het
Kcnma1 T A 14: 23,311,652 K1036I probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrch1 G T 14: 74,818,578 S278R probably damaging Het
Lrp2 C A 2: 69,432,182 probably null Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Mpzl1 G A 1: 165,605,807 Q36* probably null Het
Npr2 T C 4: 43,646,592 S647P probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Otogl A T 10: 107,869,535 C644S probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Paqr3 T C 5: 97,099,596 T218A probably benign Het
Pcdh7 C T 5: 57,722,019 S972L possibly damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ralb A G 1: 119,483,552 M19T probably benign Het
Rcan1 A G 16: 92,393,496 I185T probably benign Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Sesn3 C T 9: 14,320,373 A200V probably damaging Het
Shh T C 5: 28,458,189 E327G probably benign Het
Shmt2 G A 10: 127,518,817 A333V probably damaging Het
Slc15a2 T A 16: 36,772,028 I256F probably benign Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Taf10 A G 7: 105,743,407 probably benign Het
Tas2r139 T A 6: 42,141,755 W274R probably damaging Het
Tbc1d20 T A 2: 152,308,194 probably benign Het
Tbc1d5 A G 17: 50,782,401 S584P probably damaging Het
Tcstv1 T C 13: 119,893,871 D75G probably damaging Het
Tex10 T G 4: 48,452,039 T696P possibly damaging Het
Tgfbr1 T C 4: 47,402,863 F206S probably damaging Het
Tmem241 A T 18: 12,113,439 H51Q probably benign Het
Trim5 A T 7: 104,276,808 V182D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Ubr5 A G 15: 38,041,573 V204A probably benign Het
Ugp2 C T 11: 21,329,026 V387I probably damaging Het
Unc45b G A 11: 82,913,209 D71N probably damaging Het
Usp34 A T 11: 23,320,727 Y37F possibly damaging Het
Zfp943 A T 17: 21,993,123 I397F probably damaging Het
Other mutations in Rock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Rock1 APN 18 10080502 missense probably benign 0.44
IGL01535:Rock1 APN 18 10132119 splice site probably benign
IGL01751:Rock1 APN 18 10079113 critical splice donor site probably null
IGL01752:Rock1 APN 18 10079113 critical splice donor site probably null
IGL02318:Rock1 APN 18 10104323 splice site probably benign
IGL02420:Rock1 APN 18 10070619 splice site probably null
IGL03030:Rock1 APN 18 10070215 splice site probably benign
IGL03339:Rock1 APN 18 10097493 missense probably benign 0.00
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0480:Rock1 UTSW 18 10079120 missense possibly damaging 0.92
R0538:Rock1 UTSW 18 10132227 missense possibly damaging 0.53
R0719:Rock1 UTSW 18 10099328 missense probably damaging 1.00
R1033:Rock1 UTSW 18 10067535 missense probably benign 0.12
R1448:Rock1 UTSW 18 10070233 missense probably damaging 1.00
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1694:Rock1 UTSW 18 10136094 critical splice donor site probably null
R1862:Rock1 UTSW 18 10079207 missense probably damaging 0.99
R1995:Rock1 UTSW 18 10101026 nonsense probably null
R2177:Rock1 UTSW 18 10070263 missense probably benign 0.18
R2892:Rock1 UTSW 18 10072863 nonsense probably null
R3780:Rock1 UTSW 18 10067575 missense probably benign 0.00
R3884:Rock1 UTSW 18 10122768 missense probably damaging 1.00
R4414:Rock1 UTSW 18 10080514 missense probably damaging 1.00
R4646:Rock1 UTSW 18 10112391 missense probably benign
R4694:Rock1 UTSW 18 10136152 nonsense probably null
R4888:Rock1 UTSW 18 10122698 missense probably benign 0.06
R5085:Rock1 UTSW 18 10140210 missense probably damaging 1.00
R5884:Rock1 UTSW 18 10099361 missense probably benign 0.03
R5927:Rock1 UTSW 18 10116792 missense probably damaging 1.00
R6084:Rock1 UTSW 18 10101007 missense probably benign 0.15
R6151:Rock1 UTSW 18 10106426 missense possibly damaging 0.79
R6360:Rock1 UTSW 18 10116778 missense possibly damaging 0.52
R6892:Rock1 UTSW 18 10122612 missense probably benign 0.00
R7313:Rock1 UTSW 18 10129317 missense possibly damaging 0.73
R7397:Rock1 UTSW 18 10097599 missense possibly damaging 0.80
R7488:Rock1 UTSW 18 10122762 missense probably damaging 1.00
R7515:Rock1 UTSW 18 10067631 missense not run
R7567:Rock1 UTSW 18 10090820 missense not run
R7569:Rock1 UTSW 18 10140194 missense not run
Predicted Primers PCR Primer
(F):5'- GGCACAGCCTATTAGTACATTTG -3'
(R):5'- AGAAAACATCATCATCTGTGGC -3'

Sequencing Primer
(F):5'- CATTTGAATAACCTGTTTACTTGAGC -3'
(R):5'- CTGTCAGAATTATTTGAGTCTGG -3'
Posted On2015-07-07