Incidental Mutation 'R4353:Cdh20'
ID 327387
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Name cadherin 20
Synonyms Cdh7
MMRRC Submission 040866-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R4353 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 104696254-104923206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104906814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 547 (D547G)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
AlphaFold Q9Z0M3
Predicted Effect probably damaging
Transcript: ENSMUST00000062528
AA Change: D547G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: D547G

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Meta Mutation Damage Score 0.3427 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Alpk2 C T 18: 65,424,523 (GRCm39) R1888H possibly damaging Het
Arhgap33 C A 7: 30,223,561 (GRCm39) V823L possibly damaging Het
Atp2b2 T C 6: 113,742,745 (GRCm39) I736V probably benign Het
Atp8a1 T C 5: 67,926,451 (GRCm39) T260A probably damaging Het
B4galnt3 T C 6: 120,192,437 (GRCm39) E433G possibly damaging Het
Bzw2 A T 12: 36,173,978 (GRCm39) F99I probably damaging Het
Col27a1 G T 4: 63,143,868 (GRCm39) A519S probably benign Het
Coq6 G A 12: 84,414,923 (GRCm39) G110D probably damaging Het
Cpb1 T C 3: 20,316,708 (GRCm39) T281A probably benign Het
Cttnbp2 T C 6: 18,514,703 (GRCm39) D11G probably benign Het
Cyp2c37 A G 19: 39,988,989 (GRCm39) Y316C possibly damaging Het
Dcdc2a T A 13: 25,240,474 (GRCm39) I74N probably damaging Het
Dhx9 A G 1: 153,347,535 (GRCm39) L391P probably damaging Het
Dsc2 G T 18: 20,183,125 (GRCm39) L98I probably damaging Het
Dthd1 T A 5: 63,000,210 (GRCm39) S511T probably benign Het
Dusp2 A G 2: 127,179,256 (GRCm39) T204A probably damaging Het
Elovl5 T C 9: 77,868,199 (GRCm39) V37A probably benign Het
Etv1 A G 12: 38,907,105 (GRCm39) E369G probably damaging Het
Gem G A 4: 11,705,939 (GRCm39) R9H probably damaging Het
Heg1 A G 16: 33,530,847 (GRCm39) T108A probably benign Het
Inava C T 1: 136,153,946 (GRCm39) V180I probably damaging Het
Iqgap2 C T 13: 95,807,904 (GRCm39) V788M probably damaging Het
Kyat3 T C 3: 142,437,054 (GRCm39) probably null Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Meis2 A G 2: 115,890,044 (GRCm39) M146T probably damaging Het
Nrp2 A G 1: 62,777,576 (GRCm39) D127G probably damaging Het
Nt5el T C 13: 105,255,253 (GRCm39) Y445H probably benign Het
Nup214 T C 2: 31,867,929 (GRCm39) probably null Het
Or2h1b T A 17: 37,462,228 (GRCm39) I58F probably damaging Het
Pabpc4 C T 4: 123,184,060 (GRCm39) T191I probably damaging Het
Pcnx2 T C 8: 126,489,590 (GRCm39) H1668R probably damaging Het
Poln C T 5: 34,286,796 (GRCm39) C124Y probably benign Het
Ppp2r2a T A 14: 67,266,386 (GRCm39) I92L probably damaging Het
Prb1b T G 6: 132,290,624 (GRCm39) Y25S unknown Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rnf130 T C 11: 49,978,267 (GRCm39) V276A possibly damaging Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Rnf38 A T 4: 44,149,100 (GRCm39) N82K possibly damaging Het
Scn7a T A 2: 66,506,780 (GRCm39) M1370L probably benign Het
Sema4b C A 7: 79,865,399 (GRCm39) L125I probably damaging Het
Slc12a7 C T 13: 73,938,853 (GRCm39) T210I possibly damaging Het
Sox8 A C 17: 25,786,309 (GRCm39) *465G probably null Het
Spg11 G T 2: 121,943,675 (GRCm39) T159K possibly damaging Het
Stk36 A G 1: 74,671,966 (GRCm39) R889G possibly damaging Het
Tmbim7 A G 5: 3,711,796 (GRCm39) S14G probably benign Het
Usp16 A G 16: 87,267,242 (GRCm39) N211D probably damaging Het
Vmn1r6 C T 6: 56,979,677 (GRCm39) A113V possibly damaging Het
Zc3h14 A G 12: 98,730,219 (GRCm39) N92D possibly damaging Het
Zfp638 T C 6: 83,961,041 (GRCm39) S1206P probably damaging Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104,881,612 (GRCm39) missense probably benign 0.05
IGL00742:Cdh20 APN 1 109,993,356 (GRCm39) missense probably benign 0.22
IGL00743:Cdh20 APN 1 104,875,153 (GRCm39) missense probably benign 0.06
IGL00848:Cdh20 APN 1 104,861,981 (GRCm39) missense probably benign
IGL00861:Cdh20 APN 1 109,988,718 (GRCm39) splice site probably benign
IGL01016:Cdh20 APN 1 110,036,686 (GRCm39) critical splice donor site probably null
IGL01393:Cdh20 APN 1 104,861,969 (GRCm39) missense probably benign
IGL01396:Cdh20 APN 1 104,875,154 (GRCm39) missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104,861,832 (GRCm39) missense probably benign 0.05
IGL01538:Cdh20 APN 1 109,988,870 (GRCm39) missense probably damaging 1.00
IGL01612:Cdh20 APN 1 104,921,895 (GRCm39) missense probably benign 0.02
IGL01763:Cdh20 APN 1 109,993,520 (GRCm39) missense probably benign 0.00
IGL01765:Cdh20 APN 1 109,988,836 (GRCm39) missense probably damaging 1.00
IGL01937:Cdh20 APN 1 110,065,826 (GRCm39) missense probably benign
IGL01947:Cdh20 APN 1 104,921,649 (GRCm39) missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104,868,762 (GRCm39) missense probably damaging 1.00
IGL02020:Cdh20 APN 1 110,066,078 (GRCm39) missense probably damaging 1.00
IGL02135:Cdh20 APN 1 110,066,004 (GRCm39) nonsense probably null
IGL02226:Cdh20 APN 1 104,881,816 (GRCm39) splice site probably benign
IGL02285:Cdh20 APN 1 110,065,921 (GRCm39) missense probably damaging 1.00
IGL02318:Cdh20 APN 1 104,881,764 (GRCm39) missense probably null 0.03
IGL02326:Cdh20 APN 1 104,902,764 (GRCm39) missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104,875,190 (GRCm39) missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104,861,823 (GRCm39) start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104,868,982 (GRCm39) missense probably damaging 1.00
IGL03237:Cdh20 APN 1 110,066,037 (GRCm39) missense possibly damaging 0.89
IGL03280:Cdh20 APN 1 110,036,498 (GRCm39) nonsense probably null
IGL03347:Cdh20 APN 1 110,065,973 (GRCm39) missense possibly damaging 0.53
IGL03385:Cdh20 APN 1 109,993,516 (GRCm39) missense possibly damaging 0.90
3-1:Cdh20 UTSW 1 104,875,145 (GRCm39) missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
IGL02802:Cdh20 UTSW 1 110,065,655 (GRCm39) missense probably damaging 1.00
IGL02991:Cdh20 UTSW 1 104,861,972 (GRCm39) missense probably benign
R0030:Cdh20 UTSW 1 110,065,798 (GRCm39) nonsense probably null
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0178:Cdh20 UTSW 1 104,902,776 (GRCm39) missense possibly damaging 0.82
R0255:Cdh20 UTSW 1 109,922,036 (GRCm39) missense probably benign 0.09
R0365:Cdh20 UTSW 1 110,036,486 (GRCm39) missense probably damaging 1.00
R0506:Cdh20 UTSW 1 110,027,844 (GRCm39) missense probably damaging 1.00
R0549:Cdh20 UTSW 1 110,036,674 (GRCm39) missense probably damaging 1.00
R0599:Cdh20 UTSW 1 109,980,696 (GRCm39) missense probably damaging 1.00
R0648:Cdh20 UTSW 1 109,993,337 (GRCm39) splice site probably benign
R1033:Cdh20 UTSW 1 110,012,783 (GRCm39) missense probably damaging 0.96
R1114:Cdh20 UTSW 1 104,906,739 (GRCm39) missense probably damaging 0.96
R1173:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1174:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1175:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1401:Cdh20 UTSW 1 104,875,222 (GRCm39) missense possibly damaging 0.65
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1502:Cdh20 UTSW 1 104,881,755 (GRCm39) missense probably benign 0.06
R1587:Cdh20 UTSW 1 110,027,757 (GRCm39) missense probably damaging 0.98
R1728:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1729:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1730:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1739:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1762:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1764:Cdh20 UTSW 1 104,862,070 (GRCm39) splice site probably benign
R1769:Cdh20 UTSW 1 109,980,606 (GRCm39) missense probably damaging 1.00
R1783:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1785:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1940:Cdh20 UTSW 1 109,976,754 (GRCm39) missense probably benign 0.09
R1972:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1973:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1997:Cdh20 UTSW 1 109,976,668 (GRCm39) missense probably damaging 1.00
R2060:Cdh20 UTSW 1 109,976,607 (GRCm39) missense probably damaging 1.00
R2068:Cdh20 UTSW 1 110,065,666 (GRCm39) nonsense probably null
R2069:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R2137:Cdh20 UTSW 1 110,027,836 (GRCm39) missense probably damaging 0.97
R2155:Cdh20 UTSW 1 109,976,594 (GRCm39) missense probably damaging 1.00
R2198:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104,875,139 (GRCm39) missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104,902,740 (GRCm39) missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104,875,199 (GRCm39) missense probably damaging 1.00
R3780:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3781:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3782:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R4115:Cdh20 UTSW 1 110,066,039 (GRCm39) missense probably benign 0.37
R4243:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4277:Cdh20 UTSW 1 109,993,418 (GRCm39) missense probably benign 0.00
R4299:Cdh20 UTSW 1 109,988,731 (GRCm39) missense probably damaging 0.99
R4349:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104,862,035 (GRCm39) missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104,912,410 (GRCm39) missense probably damaging 0.99
R4777:Cdh20 UTSW 1 109,922,055 (GRCm39) nonsense probably null
R4795:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4907:Cdh20 UTSW 1 110,066,053 (GRCm39) missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104,912,528 (GRCm39) missense probably damaging 1.00
R5045:Cdh20 UTSW 1 110,026,080 (GRCm39) missense probably benign 0.01
R5056:Cdh20 UTSW 1 104,881,722 (GRCm39) missense probably benign 0.00
R5059:Cdh20 UTSW 1 109,993,430 (GRCm39) missense probably damaging 0.98
R5127:Cdh20 UTSW 1 104,875,073 (GRCm39) missense probably damaging 1.00
R5146:Cdh20 UTSW 1 109,922,042 (GRCm39) missense probably damaging 0.97
R5196:Cdh20 UTSW 1 110,065,730 (GRCm39) missense probably damaging 0.99
R5269:Cdh20 UTSW 1 104,861,882 (GRCm39) missense possibly damaging 0.67
R5304:Cdh20 UTSW 1 110,036,569 (GRCm39) missense probably damaging 1.00
R5496:Cdh20 UTSW 1 109,976,647 (GRCm39) missense probably damaging 1.00
R5563:Cdh20 UTSW 1 104,875,082 (GRCm39) missense probably benign 0.29
R5634:Cdh20 UTSW 1 104,902,800 (GRCm39) missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104,912,635 (GRCm39) missense probably damaging 1.00
R5743:Cdh20 UTSW 1 110,036,575 (GRCm39) missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104,861,823 (GRCm39) start codon destroyed probably null 0.49
R5867:Cdh20 UTSW 1 109,976,581 (GRCm39) missense probably damaging 1.00
R5933:Cdh20 UTSW 1 104,912,396 (GRCm39) missense probably damaging 1.00
R6042:Cdh20 UTSW 1 110,065,997 (GRCm39) missense probably damaging 0.97
R6092:Cdh20 UTSW 1 110,026,036 (GRCm39) missense probably benign 0.00
R6109:Cdh20 UTSW 1 104,921,739 (GRCm39) missense probably damaging 1.00
R6497:Cdh20 UTSW 1 109,993,528 (GRCm39) critical splice donor site probably null
R6521:Cdh20 UTSW 1 104,869,859 (GRCm39) missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104,912,411 (GRCm39) missense possibly damaging 0.95
R7111:Cdh20 UTSW 1 110,065,638 (GRCm39) missense
R7169:Cdh20 UTSW 1 104,875,078 (GRCm39) missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104,921,702 (GRCm39) missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104,881,796 (GRCm39) missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104,898,598 (GRCm39) missense probably benign
R7511:Cdh20 UTSW 1 109,925,583 (GRCm39) intron probably benign
R7532:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R7535:Cdh20 UTSW 1 104,902,768 (GRCm39) missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104,869,004 (GRCm39) missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104,869,024 (GRCm39) missense probably damaging 1.00
R7879:Cdh20 UTSW 1 109,976,677 (GRCm39) missense probably benign 0.01
R7879:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R7915:Cdh20 UTSW 1 104,861,898 (GRCm39) missense probably benign 0.15
R7925:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
R7978:Cdh20 UTSW 1 109,921,835 (GRCm39) start gained probably benign
R8022:Cdh20 UTSW 1 109,988,838 (GRCm39) missense probably benign 0.02
R8207:Cdh20 UTSW 1 109,922,076 (GRCm39) missense probably damaging 1.00
R8224:Cdh20 UTSW 1 109,921,933 (GRCm39) missense probably benign
R8239:Cdh20 UTSW 1 110,027,832 (GRCm39) missense probably benign 0.11
R8257:Cdh20 UTSW 1 104,921,962 (GRCm39) missense probably benign 0.25
R8444:Cdh20 UTSW 1 104,898,583 (GRCm39) missense probably benign 0.16
R8546:Cdh20 UTSW 1 104,861,769 (GRCm39) start gained probably benign
R8749:Cdh20 UTSW 1 110,027,009 (GRCm39) missense probably damaging 1.00
R8870:Cdh20 UTSW 1 104,873,048 (GRCm39) missense probably damaging 0.99
R8884:Cdh20 UTSW 1 110,027,860 (GRCm39) missense probably damaging 1.00
R9030:Cdh20 UTSW 1 110,027,843 (GRCm39) missense probably benign 0.21
R9310:Cdh20 UTSW 1 104,875,061 (GRCm39) missense probably damaging 1.00
R9498:Cdh20 UTSW 1 109,976,635 (GRCm39) missense probably benign 0.03
R9542:Cdh20 UTSW 1 104,875,067 (GRCm39) missense probably damaging 1.00
R9602:Cdh20 UTSW 1 104,868,823 (GRCm39) missense probably benign 0.07
R9658:Cdh20 UTSW 1 109,988,785 (GRCm39) missense probably damaging 0.99
R9664:Cdh20 UTSW 1 104,862,065 (GRCm39) missense probably benign 0.10
Z1088:Cdh20 UTSW 1 110,012,853 (GRCm39) missense probably benign 0.01
Z1176:Cdh20 UTSW 1 110,036,466 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTCCAGGTTTAGGATTTC -3'
(R):5'- TGCTCTGATTCGGACTAAAGG -3'

Sequencing Primer
(F):5'- GCACTCCAGGTTTAGGATTTCATTAG -3'
(R):5'- TACCACTGCACCTTGAATAGTG -3'
Posted On 2015-07-07