Incidental Mutation 'R4353:Spg11'
ID327393
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 040866-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122113194 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 159 (T159K)
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036450
AA Change: T159K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: T159K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135847
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R0927:Spg11 UTSW 2 122094487 missense probably damaging 0.99
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1555:Spg11 UTSW 2 122097377 missense probably damaging 0.99
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R3423:Spg11 UTSW 2 122071053 missense probably benign 0.00
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4663:Spg11 UTSW 2 122098099 critical splice donor site probably null
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R4829:Spg11 UTSW 2 122108455 missense probably benign 0.44
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5362:Spg11 UTSW 2 122061000 missense probably damaging 0.99
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACAGCTCAGCTTTCTACACAG -3'
(R):5'- GGAATGAGTGCAGTTTCCCTC -3'

Sequencing Primer
(F):5'- GGATACAGATCAAGCCCACTGTG -3'
(R):5'- AGTGCAGTTTCCCTCTTTGTTTTATC -3'
Posted On2015-07-07