Incidental Mutation 'R4353:Sox8'
ID327435
Institutional Source Beutler Lab
Gene Symbol Sox8
Ensembl Gene ENSMUSG00000024176
Gene NameSRY (sex determining region Y)-box 8
Synonyms
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25565892-25570686 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 25567335 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 465 (*465G)
Ref Sequence ENSEMBL: ENSMUSP00000025003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]
Predicted Effect probably null
Transcript: ENSMUST00000025003
AA Change: *465G
SMART Domains Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: *465G

DomainStartEndE-ValueType
Pfam:Sox_N 18 86 3.8e-27 PFAM
HMG 98 168 3.86e-28 SMART
low complexity region 208 228 N/A INTRINSIC
low complexity region 303 321 N/A INTRINSIC
low complexity region 375 397 N/A INTRINSIC
low complexity region 407 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163493
Predicted Effect probably benign
Transcript: ENSMUST00000173447
SMART Domains Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176

DomainStartEndE-ValueType
Pfam:Sox_N 3 87 3.3e-25 PFAM
HMG 98 168 3.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174560
SMART Domains Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176

DomainStartEndE-ValueType
HMG 1 66 1.19e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Sox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Sox8 APN 17 25567528 unclassified probably null
IGL01918:Sox8 APN 17 25570137 missense probably damaging 1.00
IGL02672:Sox8 APN 17 25568989 missense probably damaging 1.00
IGL03371:Sox8 APN 17 25567440 missense probably damaging 1.00
R1398:Sox8 UTSW 17 25567883 missense probably benign 0.01
R1673:Sox8 UTSW 17 25567482 missense possibly damaging 0.77
R1742:Sox8 UTSW 17 25567941 missense probably damaging 0.99
R4019:Sox8 UTSW 17 25570297 missense probably damaging 1.00
R4466:Sox8 UTSW 17 25568905 missense probably benign 0.37
R4893:Sox8 UTSW 17 25568989 missense probably damaging 1.00
R4929:Sox8 UTSW 17 25570356 missense probably benign 0.21
R5915:Sox8 UTSW 17 25567469 missense probably damaging 1.00
R6114:Sox8 UTSW 17 25567520 missense probably damaging 1.00
R6915:Sox8 UTSW 17 25567914 missense probably damaging 1.00
R7030:Sox8 UTSW 17 25570108 critical splice donor site probably null
R7232:Sox8 UTSW 17 25567540 missense probably benign 0.01
R7549:Sox8 UTSW 17 25567961 missense not run
Predicted Primers PCR Primer
(F):5'- AAAAGAGAGCTCTGTCCCCTGG -3'
(R):5'- CCAGCGCACAGTGTGATTAC -3'

Sequencing Primer
(F):5'- CCCTGGCAGAAGTTTGGATATCC -3'
(R):5'- TGACCTGCAGGCTTCCAAC -3'
Posted On2015-07-07