Incidental Mutation 'R4354:Tbc1d7'
ID327458
Institutional Source Beutler Lab
Gene Symbol Tbc1d7
Ensembl Gene ENSMUSG00000021368
Gene NameTBC1 domain family, member 7
Synonyms
MMRRC Submission 041107-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R4354 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location43151740-43171501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43169868 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 16 (K16E)
Ref Sequence ENSEMBL: ENSMUSP00000152208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021797] [ENSMUST00000179852] [ENSMUST00000220787] [ENSMUST00000221352] [ENSMUST00000221795] [ENSMUST00000222160] [ENSMUST00000223000]
Predicted Effect probably damaging
Transcript: ENSMUST00000021797
AA Change: K16E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021797
Gene: ENSMUSG00000021368
AA Change: K16E

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179852
AA Change: K16E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137280
Gene: ENSMUSG00000021368
AA Change: K16E

DomainStartEndE-ValueType
SCOP:d1fkma1 24 90 5e-3 SMART
Pfam:RabGAP-TBC 133 251 5.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220787
AA Change: K16E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221095
Predicted Effect probably damaging
Transcript: ENSMUST00000221352
AA Change: K16E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221795
AA Change: K16E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000222160
AA Change: K16E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000223000
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Abca8b A C 11: 109,971,692 S416A probably benign Het
Abcb4 A T 5: 8,918,771 N370I probably benign Het
Abi3bp T C 16: 56,532,951 F81S probably benign Het
Ablim1 C T 19: 57,155,278 C83Y probably damaging Het
Adamtsl1 A T 4: 86,156,684 H96L probably damaging Het
Alms1-ps1 C T 6: 85,755,635 noncoding transcript Het
AU040320 A G 4: 126,854,399 probably benign Het
Chd1 T A 17: 17,390,001 H472Q probably benign Het
Chgb A T 2: 132,793,944 D602V probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gpa33 A G 1: 166,163,835 T212A possibly damaging Het
Hspg2 C A 4: 137,468,911 A17E probably benign Het
Irf7 T C 7: 141,265,270 R8G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Loxhd1 T C 18: 77,395,427 Y1235H probably damaging Het
Mon2 T C 10: 123,026,983 T680A probably benign Het
Nab1 A T 1: 52,490,696 L14Q probably damaging Het
Neu4 C T 1: 94,024,557 T216I probably damaging Het
Nle1 A G 11: 82,906,431 C152R possibly damaging Het
Nprl3 T A 11: 32,234,906 M368L probably benign Het
Nudt9 A G 5: 104,058,111 K129E probably damaging Het
Olfr368 T C 2: 37,331,876 L43P probably damaging Het
Pdzd8 T C 19: 59,345,481 D36G probably benign Het
Pga5 C T 19: 10,674,826 probably null Het
Pold3 T C 7: 100,100,617 K47E possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,915,641 I251V probably benign Het
Susd2 G T 10: 75,639,728 F447L probably damaging Het
Tlr8 T G X: 167,242,872 Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 Y227H probably benign Het
Other mutations in Tbc1d7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Tbc1d7 APN 13 43159321 missense probably damaging 1.00
IGL01460:Tbc1d7 APN 13 43165359 missense probably benign 0.00
IGL02653:Tbc1d7 APN 13 43165398 missense probably benign
IGL03046:Tbc1d7 APN 13 43154686 splice site probably null
R0165:Tbc1d7 UTSW 13 43153202 splice site probably null
R0427:Tbc1d7 UTSW 13 43153087 missense probably benign 0.01
R0863:Tbc1d7 UTSW 13 43154685 splice site probably benign
R0930:Tbc1d7 UTSW 13 43165336 nonsense probably null
R1181:Tbc1d7 UTSW 13 43153139 missense probably damaging 1.00
R1792:Tbc1d7 UTSW 13 43165377 missense probably benign
R2113:Tbc1d7 UTSW 13 43153086 missense probably damaging 0.99
R4743:Tbc1d7 UTSW 13 43169849 missense probably damaging 1.00
R5407:Tbc1d7 UTSW 13 43154702 missense probably benign 0.01
R6049:Tbc1d7 UTSW 13 43159360 missense probably damaging 0.99
R6320:Tbc1d7 UTSW 13 43152933 unclassified probably benign
R7024:Tbc1d7 UTSW 13 43154735 missense probably damaging 1.00
R7241:Tbc1d7 UTSW 13 43153017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACAACCTTCTGCCTCTCAATGAATC -3'
(R):5'- GCTTAGGGCCAGGCAATTTATC -3'

Sequencing Primer
(F):5'- CTGCCTCTCAATGAATCTGAAAAATC -3'
(R):5'- GGGCCAGGCAATTTATCATATTTGAC -3'
Posted On2015-07-07