Incidental Mutation 'R0045:Mtor'
ID32749
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 038339-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0045 (G1)
Quality Score144
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 148464949 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 597 (H597D)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect probably benign
Transcript: ENSMUST00000103221
AA Change: H597D

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: H597D

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 unclassified probably null
motor UTSW 4 148491360 missense possibly damaging 0.76
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 unclassified probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACCATCCCACTGATTTGCAGCC -3'
(R):5'- TACAGGAGCCATGCCTTAGCAGAG -3'

Sequencing Primer
(F):5'- CACTGATTTGCAGCCAGGAG -3'
(R):5'- GGTGATCTCTACAGACCATGC -3'
Posted On2013-05-09