Incidental Mutation 'R0045:Agbl1'
ID32760
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission 038339-MU
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0045 (G1)
Quality Score192
Status Validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 76698840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably damaging
Transcript: ENSMUST00000026854
AA Change: V643A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: V643A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107442
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156166
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 286 302 N/A INTRINSIC
Pfam:Peptidase_M14 737 871 7.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206401
Meta Mutation Damage Score 0.6256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Tecta G A 9: 42,375,191 T723I probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCACTCCATACTCTTCTAGTACAGAT -3'
(R):5'- ACCAGTGAGCATTAAACCATTGTTCTGA -3'

Sequencing Primer
(F):5'- CTTCCTGGACATCTGGAGCTG -3'
(R):5'- gccaccataagccaatgacag -3'
Posted On2013-05-09