Incidental Mutation 'R4406:Ppan'
ID 327663
Institutional Source Beutler Lab
Gene Symbol Ppan
Ensembl Gene ENSMUSG00000004100
Gene Name peter pan homolog
Synonyms A230087P06Rik, SSF1
MMRRC Submission 041688-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R4406 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20799471-20803474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20802288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 226 (D226E)
Ref Sequence ENSEMBL: ENSMUSP00000004203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004203] [ENSMUST00000004206] [ENSMUST00000214331]
AlphaFold Q91YU8
Predicted Effect probably damaging
Transcript: ENSMUST00000004203
AA Change: D226E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004203
Gene: ENSMUSG00000004100
AA Change: D226E

DomainStartEndE-ValueType
Brix 32 286 1.13e-77 SMART
Blast:Brix 321 429 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000004206
SMART Domains Protein: ENSMUSP00000004206
Gene: ENSMUSG00000070319

DomainStartEndE-ValueType
Pfam:eIF3g 56 175 5.5e-45 PFAM
RRM 240 313 1.49e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213454
Predicted Effect probably benign
Transcript: ENSMUST00000214331
Meta Mutation Damage Score 0.2739 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an evolutionarily conserved protein similar to yeast SSF1 as well as to the gene product of the Drosophila gene peter pan (ppan). SSF1 is known to be involved in the second step of mRNA splicing. Both SSF1 and ppan are essential for cell growth and proliferation. Exogenous expression of this gene was reported to reduce the anchorage-independent growth of some tumor cells. Read-through transcription of this gene with P2RY11/P2Y(11), an adjacent downstream gene that encodes an ATP receptor, has been found. These read-through transcripts are ubiquitously present and up-regulated during granulocyte differentiation. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca C T 11: 84,171,275 (GRCm39) L1170F probably benign Het
Acss3 A T 10: 106,889,198 (GRCm39) D207E probably damaging Het
Adgrl1 T C 8: 84,656,671 (GRCm39) S325P probably damaging Het
Ankrd37 A G 8: 46,450,131 (GRCm39) probably benign Het
Atp13a2 C T 4: 140,733,787 (GRCm39) P1059S probably damaging Het
Camkv T C 9: 107,823,418 (GRCm39) probably null Het
Ces1f T C 8: 93,989,950 (GRCm39) T387A probably benign Het
Dmxl1 T A 18: 50,022,620 (GRCm39) L1653I probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fat2 G A 11: 55,153,094 (GRCm39) A3706V probably benign Het
Fbln1 T A 15: 85,115,757 (GRCm39) probably null Het
Gm1527 G A 3: 28,949,874 (GRCm39) V45M possibly damaging Het
Gm5084 A G 13: 60,360,380 (GRCm39) noncoding transcript Het
Itpr1 T A 6: 108,331,624 (GRCm39) H194Q probably damaging Het
Kif24 A T 4: 41,393,954 (GRCm39) L973Q probably damaging Het
Lrfn4 T C 19: 4,663,299 (GRCm39) T412A probably benign Het
Ly75 T C 2: 60,184,894 (GRCm39) E420G probably damaging Het
Map3k12 T C 15: 102,413,837 (GRCm39) T45A probably damaging Het
Mib1 A C 18: 10,763,289 (GRCm39) K446N probably damaging Het
Mrpl4 T C 9: 20,918,231 (GRCm39) W146R probably damaging Het
Myof A G 19: 37,911,426 (GRCm39) S1502P probably damaging Het
Nomo1 A G 7: 45,706,092 (GRCm39) N482S probably benign Het
Or2y1 G A 11: 49,385,744 (GRCm39) R128H probably benign Het
Or5b105 A G 19: 13,079,958 (GRCm39) S237P possibly damaging Het
Or5b96 A T 19: 12,867,598 (GRCm39) Y114* probably null Het
Or8g21 T C 9: 38,905,865 (GRCm39) I289V possibly damaging Het
Or9s15 T A 1: 92,525,036 (GRCm39) M265K possibly damaging Het
Osbpl10 C T 9: 114,938,549 (GRCm39) H70Y probably damaging Het
Pdilt A C 7: 119,094,232 (GRCm39) S340A probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sema3g G A 14: 30,950,116 (GRCm39) V766M probably benign Het
Skint6 T A 4: 113,013,683 (GRCm39) N356I probably benign Het
Slco2b1 A T 7: 99,314,096 (GRCm39) S496T probably benign Het
Trak1 T C 9: 121,260,602 (GRCm39) V11A probably damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Umod G A 7: 119,065,287 (GRCm39) P581S probably damaging Het
Zfat A G 15: 68,052,040 (GRCm39) S585P probably benign Het
Zfp472 C A 17: 33,197,134 (GRCm39) T403N probably benign Het
Zfp936 A G 7: 42,839,748 (GRCm39) Q405R possibly damaging Het
Other mutations in Ppan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Ppan APN 9 20,802,232 (GRCm39) missense probably damaging 1.00
IGL03162:Ppan APN 9 20,802,608 (GRCm39) missense probably damaging 1.00
R0279:Ppan UTSW 9 20,802,825 (GRCm39) missense probably benign 0.01
R1382:Ppan UTSW 9 20,803,214 (GRCm39) missense probably benign 0.08
R4724:Ppan UTSW 9 20,799,806 (GRCm39) missense probably benign 0.04
R5217:Ppan UTSW 9 20,802,221 (GRCm39) missense possibly damaging 0.46
R5275:Ppan UTSW 9 20,801,069 (GRCm39) nonsense probably null
R5946:Ppan UTSW 9 20,800,969 (GRCm39) nonsense probably null
R6540:Ppan UTSW 9 20,802,506 (GRCm39) splice site probably null
R7131:Ppan UTSW 9 20,802,450 (GRCm39) missense possibly damaging 0.94
R7227:Ppan UTSW 9 20,799,496 (GRCm39) unclassified probably benign
R7419:Ppan UTSW 9 20,803,140 (GRCm39) missense probably benign 0.03
R7883:Ppan UTSW 9 20,802,777 (GRCm39) missense probably benign 0.24
R9179:Ppan UTSW 9 20,803,199 (GRCm39) missense probably benign 0.00
R9357:Ppan UTSW 9 20,801,220 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGTAAACGCCCTGATGCATG -3'
(R):5'- ACCCTCACCTCAGTAAGTCG -3'

Sequencing Primer
(F):5'- GTAAACGCCCTGATGCATGTACAG -3'
(R):5'- TCACCTCAGTAAGTCGGACGG -3'
Posted On 2015-07-07