Incidental Mutation 'R0045:Tecta'
ID32770
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 038339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R0045 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42375191 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 723 (T723I)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: T723I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: T723I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: T723I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: T723I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,082,085 N299S probably damaging Het
Abi3 A G 11: 95,832,715 *368R probably null Het
Agbl1 T C 7: 76,698,840 probably null Het
Ap3b2 T C 7: 81,466,193 D650G possibly damaging Het
Arhgap30 A G 1: 171,408,430 S791G probably benign Het
Arvcf T A 16: 18,403,458 L722Q probably benign Het
Ascc3 C T 10: 50,718,402 R1198* probably null Het
Atf2 G T 2: 73,829,856 T189N probably benign Het
Atf7ip A G 6: 136,559,816 K16E probably damaging Het
Atg9b G T 5: 24,387,398 Q621K probably damaging Het
Atp12a G A 14: 56,372,873 E234K probably damaging Het
C8a T C 4: 104,826,815 K368E probably benign Het
Cdh23 T C 10: 60,530,978 Y241C probably damaging Het
Cdon G A 9: 35,486,807 S940N probably benign Het
Cds2 G T 2: 132,305,155 G402V possibly damaging Het
Cog6 T C 3: 52,992,750 probably null Het
Commd10 T C 18: 46,967,836 S114P possibly damaging Het
Dram2 T C 3: 106,570,817 V155A possibly damaging Het
Egr2 T A 10: 67,540,480 V252E probably benign Het
Exoc3l C T 8: 105,293,685 V203M probably damaging Het
Fsip1 C A 2: 118,248,292 probably null Het
Gm10840 C A 11: 106,161,100 probably benign Het
Gm8251 T C 1: 44,057,205 K1578E probably benign Het
Gpr37l1 A G 1: 135,161,145 L394P probably damaging Het
Gsap T C 5: 21,226,832 M243T possibly damaging Het
Hsd3b5 T A 3: 98,619,144 I329F probably benign Het
Htra1 T A 7: 130,961,532 S164R probably damaging Het
Il17b G A 18: 61,690,244 V50M probably damaging Het
Itga4 A T 2: 79,301,031 Y581F probably damaging Het
Jmjd8 A G 17: 25,829,281 E92G probably damaging Het
Kcnq4 T A 4: 120,697,955 D677V probably damaging Het
Klhl42 A G 6: 147,092,168 T213A probably benign Het
Lcn5 T C 2: 25,660,698 S133P probably damaging Het
Liph T C 16: 21,968,053 Y271C probably damaging Het
Lpcat3 T C 6: 124,701,474 I228T probably benign Het
Lrrd1 A G 5: 3,866,418 K812E possibly damaging Het
Ltbp2 G A 12: 84,809,587 T701I probably damaging Het
Ltbp2 T C 12: 84,813,288 T631A probably damaging Het
Mavs G A 2: 131,238,831 R13Q probably damaging Het
Mtor C G 4: 148,464,949 H597D probably benign Het
Muc5b T A 7: 141,856,818 H1309Q unknown Het
Myl3 A C 9: 110,767,929 D119A probably damaging Het
Nnat A T 2: 157,560,488 probably benign Het
Olfr183 G A 16: 59,000,491 D269N probably benign Het
Olfr293 T C 7: 86,664,340 L226S possibly damaging Het
Olfr703 T A 7: 106,845,389 Y259* probably null Het
Olfr869 A T 9: 20,137,191 Q25L probably benign Het
Pclo C T 5: 14,539,471 A595V unknown Het
Pcsk6 T A 7: 65,962,928 C315S probably damaging Het
Pkd2 T A 5: 104,455,805 probably benign Het
Ppp2r3c T A 12: 55,293,821 I155F probably damaging Het
Rapgef4 A G 2: 72,198,778 H398R possibly damaging Het
Ripor2 A G 13: 24,694,226 D328G probably damaging Het
Rpgrip1 A T 14: 52,141,144 T509S possibly damaging Het
Sh3pxd2a A G 19: 47,267,183 I1032T probably damaging Het
Slc25a13 A T 6: 6,109,277 S362T probably benign Het
Stk35 A T 2: 129,800,568 R10* probably null Het
Tal1 A G 4: 115,068,565 D277G probably damaging Het
Trp53bp1 A C 2: 121,204,497 V103G probably benign Het
Trpv4 A G 5: 114,636,457 S189P probably benign Het
Ttll5 T G 12: 85,879,359 probably benign Het
Usp8 A G 2: 126,742,223 T451A probably benign Het
Vac14 G A 8: 110,636,952 D340N probably benign Het
Vars C A 17: 34,998,066 A471S probably benign Het
Vars A T 17: 35,010,619 H404L probably damaging Het
Vmn2r70 T C 7: 85,566,044 N94S probably damaging Het
Vpreb2 T C 16: 17,980,767 L39P probably damaging Het
Vps13a A T 19: 16,640,810 L693* probably null Het
Wapl A G 14: 34,733,794 I176V probably benign Het
Wdr31 G T 4: 62,464,033 L4I possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0479:Tecta UTSW 9 42337939 missense probably damaging 1.00
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCAGAGGAAGAATGTCAAGTC -3'
(R):5'- TGCAGTGCTTATGCGAAGAGGG -3'

Sequencing Primer
(F):5'- TTCTGTCACTCCATCGAAGGAAG -3'
(R):5'- GAGGGGATGTCTACTGCTTCAAC -3'
Posted On2013-05-09