Incidental Mutation 'R4407:Tgm4'
ID327715
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Nametransglutaminase 4 (prostate)
Synonyms9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
MMRRC Submission 041689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4407 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123034726-123067561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123056530 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 379 (D379V)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
Predicted Effect probably damaging
Transcript: ENSMUST00000026893
AA Change: D379V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: D379V

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171897
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830035A12Rik T C 11: 107,532,055 noncoding transcript Het
Bbs10 A G 10: 111,299,859 T278A probably benign Het
BC053393 A G 11: 46,577,380 T94A probably damaging Het
Bcl6b A G 11: 70,226,103 L450P probably damaging Het
Braf T G 6: 39,615,720 K674Q probably damaging Het
Cep112 C T 11: 108,519,201 T481I possibly damaging Het
Cep135 T A 5: 76,624,667 M633K probably benign Het
Cpped1 T C 16: 11,805,421 Y278C probably damaging Het
Depdc5 T A 5: 32,904,534 probably null Het
Dolpp1 C T 2: 30,396,452 A128V possibly damaging Het
E2f5 T A 3: 14,603,763 D238E probably benign Het
Fat4 A T 3: 38,958,540 D2328V probably benign Het
Fbln1 T A 15: 85,231,556 probably null Het
Fkbp3 T C 12: 65,070,004 T53A probably damaging Het
Flg2 G T 3: 93,214,869 G1449C unknown Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glyctk A T 9: 106,157,108 probably benign Het
Gm37596 C A 3: 93,692,112 V317L probably benign Het
Gm6430 T C 1: 97,025,572 noncoding transcript Het
Golga1 C A 2: 39,019,641 probably null Het
Gucy2g A T 19: 55,237,837 F216I probably benign Het
L3mbtl3 A G 10: 26,313,884 V494A unknown Het
Lama2 AATCAGACAGGAG A 10: 27,212,128 probably benign Het
Lemd3 A T 10: 120,925,430 L907Q possibly damaging Het
Lrp2 A T 2: 69,502,517 V1552D probably damaging Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Mycbp2 A T 14: 103,287,228 D665E probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1178 A T 2: 88,392,083 M279L probably benign Het
Pcdhac2 G T 18: 37,144,446 V160L probably benign Het
Pcnt T C 10: 76,374,870 E2473G possibly damaging Het
Pitpnm2 T A 5: 124,152,615 I3L possibly damaging Het
Prkd3 C A 17: 78,983,558 W176L probably damaging Het
Prpf39 C T 12: 65,056,266 A438V probably damaging Het
Rpgrip1 T A 14: 52,147,399 F655I probably damaging Het
Rrp12 T C 19: 41,892,551 Y147C probably damaging Het
Sec23b A T 2: 144,574,718 N429Y possibly damaging Het
Slc2a10 T A 2: 165,514,764 S115T probably damaging Het
Spg11 A C 2: 122,075,332 D1277E probably benign Het
Sspo A G 6: 48,460,520 D1279G probably damaging Het
St18 T C 1: 6,827,837 I621T probably benign Het
Tbc1d31 T A 15: 57,920,042 D112E possibly damaging Het
Thyn1 A T 9: 27,003,597 D15V possibly damaging Het
Tm4sf19 T C 16: 32,407,894 V167A possibly damaging Het
Trim38 A C 13: 23,791,491 Q471P probably benign Het
Trmt1 T A 8: 84,697,755 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp9y T C Y: 1,336,375 I1500V probably benign Het
Vgll4 C T 6: 114,890,612 probably null Het
Vmn1r173 T A 7: 23,703,016 N225K probably damaging Het
Vmn2r22 C T 6: 123,637,954 G226R probably damaging Het
Wnk3 C A X: 151,233,213 P555Q probably benign Het
Yes1 T G 5: 32,640,585 Y83D possibly damaging Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7369:Tgm4 UTSW 9 123056684 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTACCTGTTGCCTCCCTG -3'
(R):5'- GAACTGGCCTGTAACGACAC -3'

Sequencing Primer
(F):5'- GCGGGATTTCTTACTGTTACCG -3'
(R):5'- TGTAACGACACAGCTACCTTCTGG -3'
Posted On2015-07-07