Incidental Mutation 'R4408:Hnrnpu'
ID327748
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Nameheterogeneous nuclear ribonucleoprotein U
SynonymsHnrpu, scaffold attachment factor A, Sp120
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location178321108-178337797 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 178330803 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: I628M
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: I628M

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150825
Predicted Effect unknown
Transcript: ENSMUST00000161769
AA Change: I628M
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: I628M

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162916
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect probably benign
Transcript: ENSMUST00000189450
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178330774 unclassified probably benign
R1136:Hnrnpu UTSW 1 178331225 unclassified probably benign
R1205:Hnrnpu UTSW 1 178332169 unclassified probably benign
R1317:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1318:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1778:Hnrnpu UTSW 1 178325241 critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3161:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R4667:Hnrnpu UTSW 1 178332181 unclassified probably benign
R4833:Hnrnpu UTSW 1 178333894 unclassified probably benign
R4906:Hnrnpu UTSW 1 178329373 intron probably benign
R4923:Hnrnpu UTSW 1 178331452 unclassified probably benign
R5000:Hnrnpu UTSW 1 178329376 intron probably benign
R5256:Hnrnpu UTSW 1 178335893 missense unknown
R5307:Hnrnpu UTSW 1 178337312 missense unknown
R5911:Hnrnpu UTSW 1 178330172 unclassified probably benign
R6931:Hnrnpu UTSW 1 178331432 unclassified probably benign
R7061:Hnrnpu UTSW 1 178336126 missense unknown
R7077:Hnrnpu UTSW 1 178332191 missense unknown
R7391:Hnrnpu UTSW 1 178337078 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCTGAAATTGCCACCTCG -3'
(R):5'- AAGTACGGTTTGGGGATTTATACC -3'

Sequencing Primer
(F):5'- GAAATTGCCACCTCGCATATTG -3'
(R):5'- AATGTGATGAAGGCCGTG -3'
Posted On2015-07-07