Incidental Mutation 'R4408:Fndc5'
ID327755
Institutional Source Beutler Lab
Gene Symbol Fndc5
Ensembl Gene ENSMUSG00000001334
Gene Namefibronectin type III domain containing 5
Synonyms1500001L03Rik, PeP, Pxp
MMRRC Submission 041690-MU
Accession Numbers

Genbank: NM_027402; MGI: 1917614  

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129136999-129144593 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 129142529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102600]
Predicted Effect probably null
Transcript: ENSMUST00000102600
SMART Domains Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334

DomainStartEndE-ValueType
FN3 31 111 7.34e-9 SMART
Pfam:DUF4808 146 204 4.7e-10 PFAM
Meta Mutation Damage Score 0.6028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Fndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Fndc5 APN 4 129139446 missense probably damaging 1.00
IGL03336:Fndc5 APN 4 129139918 missense probably benign 0.00
N/A - 287:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
R0645:Fndc5 UTSW 4 129139837 splice site probably benign
R1202:Fndc5 UTSW 4 129139445 missense probably damaging 0.97
R3962:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R5379:Fndc5 UTSW 4 129142094 missense probably damaging 1.00
R5539:Fndc5 UTSW 4 129138721 missense probably damaging 1.00
R6242:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R6951:Fndc5 UTSW 4 129138780 missense possibly damaging 0.77
R7027:Fndc5 UTSW 4 129139523 missense probably benign 0.00
R7112:Fndc5 UTSW 4 129142122 missense probably benign 0.09
Z31818:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTGCCTTTTGCGGAG -3'
(R):5'- TCAGCCATGGACATTGCTG -3'

Sequencing Primer
(F):5'- CCTTTTGCGGAGTGCCAAG -3'
(R):5'- CCATGGACATTGCTGAGGTAC -3'
Posted On2015-07-07