Incidental Mutation 'R4409:Gm13178'
ID327798
Institutional Source Beutler Lab
Gene Symbol Gm13178
Ensembl Gene ENSMUSG00000041735
Gene Namepredicted gene 13178
Synonyms
MMRRC Submission 041691-MU
Accession Numbers

Ncbi RefSeq: NM_001085536.1; MGI: 3650721

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144703191-144721404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144721302 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 35 (S35T)
Ref Sequence ENSEMBL: ENSMUSP00000045343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036876]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036876
AA Change: S35T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045343
Gene: ENSMUSG00000041735
AA Change: S35T

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 43 60 N/A INTRINSIC
low complexity region 79 84 N/A INTRINSIC
Pfam:Abhydrolase_3 116 286 2.3e-27 PFAM
Pfam:Abhydrolase_3 287 382 8.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pcx A G 19: 4,610,003 K442R possibly damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Gm13178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Gm13178 APN 4 144703693 missense possibly damaging 0.87
IGL01985:Gm13178 APN 4 144715454 nonsense probably null
IGL02587:Gm13178 APN 4 144703399 missense possibly damaging 0.94
P0018:Gm13178 UTSW 4 144703197 missense probably benign 0.00
R0395:Gm13178 UTSW 4 144703195 missense probably benign 0.14
R1617:Gm13178 UTSW 4 144715391 missense probably damaging 1.00
R3802:Gm13178 UTSW 4 144703504 missense possibly damaging 0.82
R4577:Gm13178 UTSW 4 144703753 missense probably damaging 1.00
R4603:Gm13178 UTSW 4 144703228 missense probably benign 0.00
R5069:Gm13178 UTSW 4 144703867 missense probably damaging 1.00
R5801:Gm13178 UTSW 4 144703636 missense probably damaging 1.00
R5802:Gm13178 UTSW 4 144703636 missense probably damaging 1.00
R5893:Gm13178 UTSW 4 144703196 missense probably benign
R6148:Gm13178 UTSW 4 144721317 missense possibly damaging 0.89
R6466:Gm13178 UTSW 4 144703867 missense probably damaging 1.00
R6655:Gm13178 UTSW 4 144705245 missense probably damaging 1.00
R7006:Gm13178 UTSW 4 144721283 missense probably benign 0.00
R7021:Gm13178 UTSW 4 144715492 missense probably damaging 1.00
R7030:Gm13178 UTSW 4 144703603 missense possibly damaging 0.85
R7514:Gm13178 UTSW 4 144703228 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCCCCAAACCAGTTTTAGGAG -3'
(R):5'- TGAGAAACTGGTCAGGTGAC -3'

Sequencing Primer
(F):5'- CCCAAACCAGTTTTAGGAGAATCTTG -3'
(R):5'- GTAAAACTAGACCCAGTGCTCTTTC -3'
Posted On2015-07-07