Incidental Mutation 'R4409:Pcx'
ID327841
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission 041691-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4409 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4610003 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 442 (K442R)
Ref Sequence ENSEMBL: ENSMUSP00000153479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053597] [ENSMUST00000068004] [ENSMUST00000113822] [ENSMUST00000113825] [ENSMUST00000224726]
Predicted Effect probably benign
Transcript: ENSMUST00000053597
SMART Domains Protein: ENSMUSP00000050039
Gene: ENSMUSG00000045045

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068004
AA Change: K443R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: K443R

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113822
SMART Domains Protein: ENSMUSP00000109453
Gene: ENSMUSG00000045045

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113825
AA Change: K442R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: K442R

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224726
AA Change: K442R

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,872,922 L1085V probably damaging Het
Adgrf5 T C 17: 43,441,847 V560A probably damaging Het
Ambp C A 4: 63,152,647 S65I probably damaging Het
Ash1l A G 3: 89,007,199 D1712G probably damaging Het
Capn7 T C 14: 31,355,339 L338P probably damaging Het
Car2 T A 3: 14,895,102 S105T probably damaging Het
Casr A G 16: 36,500,341 C482R probably benign Het
Ccdc18 C T 5: 108,220,842 Q1277* probably null Het
Clca1 A G 3: 145,006,027 F736L probably damaging Het
Col6a1 T C 10: 76,721,500 H206R probably benign Het
Crybg1 C T 10: 43,998,758 A785T possibly damaging Het
Cyp2c68 T A 19: 39,739,452 E85D probably damaging Het
Dnah9 T C 11: 66,085,477 S1249G possibly damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fbxw24 A T 9: 109,608,188 D210E probably damaging Het
Fcgr1 T C 3: 96,284,577 Y305C probably benign Het
Gm10226 G T 17: 21,691,969 C37F possibly damaging Het
Gm13178 A T 4: 144,721,302 S35T possibly damaging Het
Gm8909 T A 17: 36,165,850 H244L possibly damaging Het
Greb1l A G 18: 10,503,182 Y411C possibly damaging Het
Grin1 T C 2: 25,310,439 N224D possibly damaging Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Il1rap G A 16: 26,712,265 probably null Het
Iqcg A G 16: 33,045,518 probably null Het
Klhdc3 C T 17: 46,677,018 G249E probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Macrod2 T G 2: 140,418,857 H68Q possibly damaging Het
Morn4 T C 19: 42,078,547 T2A possibly damaging Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Msh5 T C 17: 35,039,250 D300G probably damaging Het
Myo10 A G 15: 25,807,869 Y1859C probably damaging Het
Nacc1 A G 8: 84,673,044 *515Q probably null Het
Olfr1378 T A 11: 50,969,396 I126N probably damaging Het
Olfr722 T A 14: 49,895,773 T10S probably benign Het
Olfr998 T C 2: 85,590,930 L130S probably damaging Het
Oxgr1 C T 14: 120,022,160 V212M possibly damaging Het
P3h2 G C 16: 26,105,290 R132G possibly damaging Het
Pcdha9 T A 18: 36,999,145 H422Q probably benign Het
Pcdhga12 A G 18: 37,768,085 T657A probably damaging Het
Pkd2 T C 5: 104,466,884 silent Het
Plg T G 17: 12,390,263 C152G probably damaging Het
Plk4 A G 3: 40,806,549 E438G probably damaging Het
Ryr3 A G 2: 112,730,308 L3016P probably damaging Het
Sdccag8 T G 1: 176,868,366 probably null Het
Slc24a1 A T 9: 64,948,224 M467K probably benign Het
Sorl1 T G 9: 42,035,448 I856L probably damaging Het
Spag7 T C 11: 70,664,862 D83G probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,664,278 N170S probably benign Het
Tnfrsf1b G A 4: 145,224,285 Q253* probably null Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Ttn A G 2: 76,897,643 probably benign Het
Vmn1r213 A C 13: 23,011,423 probably benign Het
Vmn1r54 C A 6: 90,269,882 Y259* probably null Het
Vmn1r55 A G 7: 5,147,076 V116A probably benign Het
Vmn2r120 T C 17: 57,509,477 N626S probably damaging Het
Vmn2r58 A G 7: 41,872,627 F15S possibly damaging Het
Vmn2r73 A T 7: 85,871,560 V400E probably damaging Het
Zbtb39 A G 10: 127,742,827 I423M possibly damaging Het
Zfp352 A G 4: 90,225,164 N514D probably benign Het
Zfp451 A T 1: 33,777,413 H485Q probably damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGTTTCCATCCCAACGCTGAC -3'
(R):5'- CTTAGTCAGAGACCCAGCAG -3'

Sequencing Primer
(F):5'- GACTTGCGCTTCCCTCTGG -3'
(R):5'- CCAGGAGAGATTACTGTGCCACTG -3'
Posted On2015-07-07